19-35732782-CTCGGGGCCAGGGCACGCCTCCT-C
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_014727.3(KMT2B):c.6245_6266delGCACGCCTCCTTCGGGGCCAGG(p.Gly2082GlufsTer2) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_014727.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- complex neurodevelopmental disorder with motor featuresInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- dystonia 28, childhood-onsetInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet, Genomics England PanelApp
- intellectual developmental disorder, autosomal dominant 68Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_014727.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KMT2B | TSL:1 MANE Select | c.6245_6266delGCACGCCTCCTTCGGGGCCAGG | p.Gly2082GlufsTer2 | frameshift | Exon 28 of 37 | ENSP00000398837.2 | Q9UMN6 | ||
| KMT2B | c.6179_6200delGCACGCCTCCTTCGGGGCCAGG | p.Gly2060GlufsTer2 | frameshift | Exon 28 of 37 | ENSP00000501283.1 | A0A669KBI7 | |||
| KMT2B | c.1466_1487delGCACGCCTCCTTCGGGGCCAGG | p.Gly489GlufsTer2 | frameshift | Exon 7 of 8 | ENSP00000508674.1 | A0A8I5KUL1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at