chr19-35732782-CTCGGGGCCAGGGCACGCCTCCT-C

Variant names:

• chr19-35732782-CTCGGGGCCAGGGCACGCCTCCT-C
• NM_014727.3:c.6245_6266delGCACGCCTCCTTCGGGGCCAGG

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_014727.3(KMT2B):​c.6245_6266delGCACGCCTCCTTCGGGGCCAGG​(p.Gly2082GlufsTer2) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KMT2B NM_014727.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.71

Genes affected

KMT2B (HGNC:15840): (lysine methyltransferase 2B) This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 19-35732782-CTCGGGGCCAGGGCACGCCTCCT-C is Pathogenic according to our data. Variant chr19-35732782-CTCGGGGCCAGGGCACGCCTCCT-C is described in ClinVar as [Pathogenic]. Clinvar id is 2710555.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KMT2B	NM_014727.3	c.6245_6266delGCACGCCTCCTTCGGGGCCAGG	p.Gly2082GlufsTer2	frameshift_variant	Exon 28 of 37	ENST00000420124.4	NP_055542.1
KMT2B	XM_011527561.3	c.6179_6200delGCACGCCTCCTTCGGGGCCAGG	p.Gly2060GlufsTer2	frameshift_variant	Exon 28 of 37		XP_011525863.3
KMT2B	XM_011527562.3	c.6245_6266delGCACGCCTCCTTCGGGGCCAGG	p.Gly2082GlufsTer2	frameshift_variant	Exon 28 of 36		XP_011525864.1
KMT2B	XM_047439787.1	c.5969_5990delGCACGCCTCCTTCGGGGCCAGG	p.Gly1990GlufsTer2	frameshift_variant	Exon 27 of 36		XP_047295743.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KMT2B	ENST00000420124.4	c.6245_6266delGCACGCCTCCTTCGGGGCCAGG	p.Gly2082GlufsTer2	frameshift_variant	Exon 28 of 37	1	NM_014727.3	ENSP00000398837.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Jan 21, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Gly2082Glufs*2) in the KMT2B gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in KMT2B are known to be pathogenic (PMID: 27839873, 27992417). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with KMT2B-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-36223683;