19-38458215-CCGGCGAGGGCTGGGGCGGCAACGGGGT-C
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP3PP5
The NM_000540.3(RYR1):c.2097_2123delGGGCTGGGGCGGCAACGGGGTCGGCGA(p.Glu699_Gly707del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_000540.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- malignant hyperthermia, susceptibility to, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
- congenital multicore myopathy with external ophthalmoplegiaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- RYR1-related myopathyInheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
- central core myopathyInheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
- King-Denborough syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- malignant hyperthermia of anesthesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive centronuclear myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- benign Samaritan congenital myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- congenital myopathy with myasthenic-like onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- lethal multiple pterygium syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000540.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RYR1 | NM_000540.3 | MANE Select | c.2097_2123delGGGCTGGGGCGGCAACGGGGTCGGCGA | p.Glu699_Gly707del | disruptive_inframe_deletion | Exon 18 of 106 | NP_000531.2 | P21817-1 | |
| RYR1 | NM_001042723.2 | c.2097_2123delGGGCTGGGGCGGCAACGGGGTCGGCGA | p.Glu699_Gly707del | disruptive_inframe_deletion | Exon 18 of 105 | NP_001036188.1 | P21817-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RYR1 | ENST00000359596.8 | TSL:5 MANE Select | c.2097_2123delGGGCTGGGGCGGCAACGGGGTCGGCGA | p.Glu699_Gly707del | disruptive_inframe_deletion | Exon 18 of 106 | ENSP00000352608.2 | P21817-1 | |
| RYR1 | ENST00000355481.8 | TSL:1 | c.2097_2123delGGGCTGGGGCGGCAACGGGGTCGGCGA | p.Glu699_Gly707del | disruptive_inframe_deletion | Exon 18 of 105 | ENSP00000347667.3 | P21817-2 | |
| RYR1 | ENST00000594335.6 | TSL:1 | n.2097_2123delGGGCTGGGGCGGCAACGGGGTCGGCGA | non_coding_transcript_exon | Exon 18 of 103 | ENSP00000470927.2 | M0R014 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at