19-45770204-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-C

Position:

• chr19-45770204-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-C

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The NM_004409.5(DMPK):​c.*248_*283delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00563 in 715,496 control chromosomes in the GnomAD database, including 34 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.0082 (6 hom., cov: 0)
  • Exomes 𝑓: 0.0050 (28 hom.)
• Consequence: DMPK NM_004409.5 3_prime_UTR
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.00

Genes affected

DMPK (HGNC:2933): (DM1 protein kinase) The protein encoded by this gene is a serine-threonine kinase that is closely related to other kinases that interact with members of the Rho family of small GTPases. Substrates for this enzyme include myogenin, the beta-subunit of the L-type calcium channels, and phospholemman. The 3' untranslated region of this gene contains 5-38 copies of a CTG trinucleotide repeat. Expansion of this unstable motif to 50-5,000 copies causes myotonic dystrophy type I, which increases in severity with increasing repeat element copy number. Repeat expansion is associated with condensation of local chromatin structure that disrupts the expression of genes in this region. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2016]

DM1-AS (HGNC:53125): (DM1 locus antisense RNA)

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP6: Variant 19-45770204-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-C is Benign according to our data. Variant chr19-45770204-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-C is described in ClinVar as [Benign]. Clinvar id is 2650126.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAd4 at 6 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
DMPK	NM_004409.5	c.*248_*283delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		3_prime_UTR_variant	15/15	ENST00000291270.9	NP_004400.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
DMPK	ENST00000291270	c.*248_*283delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		3_prime_UTR_variant	15/15	5	NM_004409.5	ENSP00000291270.4

Frequencies

GnomAD3 genomes AF: 0.00816 AC: 1224 AN: 149918 Hom.: 6 Cov.: 0

Gnomad AFR AF: 0.0132

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00478

Gnomad ASJ AF: 0.0186

Gnomad EAS AF: 0.000796

Gnomad SAS AF: 0.00600

Gnomad FIN AF: 0.000389

Gnomad MID AF: 0.00637

Gnomad NFE AF: 0.00740

Gnomad OTH AF: 0.00682

GnomAD4 exome AF: 0.00495 AC: 2801 AN: 565462 Hom.: 28 AF XY: 0.00488 AC XY: 1469 AN XY: 300806

Gnomad4 AFR exome AF: 0.00927

Gnomad4 AMR exome AF: 0.00239

Gnomad4 ASJ exome AF: 0.0136

Gnomad4 EAS exome AF: 0.000295

Gnomad4 SAS exome AF: 0.00505

Gnomad4 FIN exome AF: 0.000793

Gnomad4 NFE exome AF: 0.00520

Gnomad4 OTH exome AF: 0.00685

GnomAD4 genome AF: 0.00818 AC: 1228 AN: 150034 Hom.: 6 Cov.: 0 AF XY: 0.00806 AC XY: 590 AN XY: 73156

Gnomad4 AFR AF: 0.0132

Gnomad4 AMR AF: 0.00477

Gnomad4 ASJ AF: 0.0186

Gnomad4 EAS AF: 0.000798

Gnomad4 SAS AF: 0.00622

Gnomad4 FIN AF: 0.000389

Gnomad4 NFE AF: 0.00740

Gnomad4 OTH AF: 0.00675

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

CeGaT Center for Human Genetics Tuebingen

Feb 01, 2023

DMPK: BS1, BS2 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-46273462;