19-46838556-A-AGGGGAGACCCTGGGGTGAGAC

Variant names:

• chr19-46838556-A-AGGGGAGACCCTGGGGTGAGAC
• rs1409640128
• NM_004069.6:c.328-29_328-9dupGTCTCACCCCAGGGTCTCCCC

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2

The NM_004069.6(AP2S1):​c.328-29_328-9dupGTCTCACCCCAGGGTCTCCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000684 in 1,461,836 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000068 (0 hom.)
• Consequence: AP2S1 NM_004069.6 intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.658
• Publications: 0 publications found

Genes affected

AP2S1 (HGNC:565): (adaptor related protein complex 2 subunit sigma 1) One of two major clathrin-associated adaptor complexes, AP-2, is a heterotetramer which is associated with the plasma membrane. This complex is composed of two large chains, a medium chain, and a small chain. This gene encodes the small chain of this complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

AP2S1 Gene-Disease associations (from GenCC):

• familial hypocalciuric hypercalcemia 3

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• neurodevelopmental disorder

  Inheritance: AD Classification: MODERATE Submitted by: G2P
• autism spectrum disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• complex neurodevelopmental disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• BS2: High AC in GnomAdExome4 at 10 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004069.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AP2S1	NM_004069.6	MANE Select	c.328-29_328-9dupGTCTCACCCCAGGGTCTCCCC		intron	N/A	NP_004060.2	P53680-1
	AP2S1	NM_001301076.3		c.376-29_376-9dupGTCTCACCCCAGGGTCTCCCC		intron	N/A	NP_001288005.1	M0QYZ2
	AP2S1	NM_001301078.3		c.370-29_370-9dupGTCTCACCCCAGGGTCTCCCC		intron	N/A	NP_001288007.1	X6R390

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AP2S1	ENST00000263270.11	TSL:1 MANE Select	c.328-9_328-8insGTCTCACCCCAGGGTCTCCCC		intron	N/A	ENSP00000263270.6	P53680-1
	AP2S1	ENST00000597020.5	TSL:1	c.268-9_268-8insGTCTCACCCCAGGGTCTCCCC		intron	N/A	ENSP00000470235.1	M0QZ21
	AP2S1	ENST00000600964.1	TSL:1	n.82-9_82-8insGTCTCACCCCAGGGTCTCCCC		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251314 AF XY: 0.00000736

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000289

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000684 AC: 10 AN: 1461836 Hom.: 0 Cov.: 31 AF XY: 0.00000963 AC XY: 7 AN XY: 727222

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.0000447 AC: 2 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26134

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53412

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.00000630 AC: 7 AN: 1111970

Other (OTH) AF: 0.0000166 AC: 1 AN: 60396

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.66

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1409640128; hg19: chr19-47341813;