19-46838556-A-AGGGGAGACCCTGGGGTGAGAC

Variant names:

• chr19-46838556-A-AGGGGAGACCCTGGGGTGAGAC
• rs1409640128
• NM_004069.6:c.328-29_328-9dupGTCTCACCCCAGGGTCTCCCC

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_004069.6(AP2S1):​c.328-29_328-9dupGTCTCACCCCAGGGTCTCCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000684 in 1,461,836 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000068 (0 hom.)
• Consequence: AP2S1 NM_004069.6 intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.658

Genes affected

AP2S1 (HGNC:565): (adaptor related protein complex 2 subunit sigma 1) One of two major clathrin-associated adaptor complexes, AP-2, is a heterotetramer which is associated with the plasma membrane. This complex is composed of two large chains, a medium chain, and a small chain. This gene encodes the small chain of this complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAdExome4 at 10 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AP2S1	NM_004069.6	c.328-29_328-9dupGTCTCACCCCAGGGTCTCCCC		intron_variant	Intron 4 of 4	ENST00000263270.11	NP_004060.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AP2S1	ENST00000263270.11	c.328-9_328-8insGTCTCACCCCAGGGTCTCCCC		intron_variant	Intron 4 of 4	1	NM_004069.6	ENSP00000263270.6

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.00000398 AC: 1 AN: 251314 Hom.: 0 AF XY: 0.00000736 AC XY: 1 AN XY: 135834

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000289

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000684 AC: 10 AN: 1461836 Hom.: 0 Cov.: 31 AF XY: 0.00000963 AC XY: 7 AN XY: 727222

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000447

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000630

Gnomad4 OTH exome AF: 0.0000166

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Dec 11, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with AP2S1-related conditions. This variant is present in population databases (no rsID available, gnomAD 0.003%). This sequence change falls in intron 4 of the AP2S1 gene. It does not directly change the encoded amino acid sequence of the AP2S1 protein. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1409640128; hg19: chr19-47341813;