NM_004069.6:c.328-29_328-9dupGTCTCACCCCAGGGTCTCCCC
Variant summary
Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2
The NM_004069.6(AP2S1):c.328-29_328-9dupGTCTCACCCCAGGGTCTCCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000684 in 1,461,836 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_004069.6 intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 exomes AF: 0.00000398 AC: 1AN: 251314Hom.: 0 AF XY: 0.00000736 AC XY: 1AN XY: 135834
GnomAD4 exome AF: 0.00000684 AC: 10AN: 1461836Hom.: 0 Cov.: 31 AF XY: 0.00000963 AC XY: 7AN XY: 727222
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not provided Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. This variant has not been reported in the literature in individuals affected with AP2S1-related conditions. This variant is present in population databases (no rsID available, gnomAD 0.003%). This sequence change falls in intron 4 of the AP2S1 gene. It does not directly change the encoded amino acid sequence of the AP2S1 protein. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at