19-50398824-TCCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGG-T

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2

The NM_002691.4(POLD1):​c.-1-25_16delCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGGC variant causes a splice acceptor, 5 prime UTR truncation, exon loss, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

POLD1
NM_002691.4 splice_acceptor, 5_prime_UTR_truncation, exon_loss, splice_region, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 0.901
Variant links:
Genes affected
POLD1 (HGNC:9175): (DNA polymerase delta 1, catalytic subunit) This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 10 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
POLD1NM_002691.4 linkc.-1-25_16delCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGGC p.Met1fs frameshift_variant, start_lost, splice_region_variant Exon 2 of 27 ENST00000440232.7 NP_002682.2 P28340A0A024R4F4Q59FA0
POLD1NM_002691.4 linkc.-1-25_16delCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGGC splice_acceptor_variant, 5_prime_UTR_truncation, exon_loss_variant, splice_region_variant, intron_variant Exon 2 of 27 ENST00000440232.7 NP_002682.2 P28340A0A024R4F4Q59FA0

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
POLD1ENST00000440232.7 linkc.-1-26_15delCCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGG p.Met1fs frameshift_variant, start_lost, splice_region_variant Exon 2 of 27 1 NM_002691.4 ENSP00000406046.1 P28340
POLD1ENST00000440232 linkc.-1-26_15delCCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGG splice_acceptor_variant, 5_prime_UTR_truncation, exon_loss_variant, splice_region_variant, intron_variant Exon 2 of 27 1 NM_002691.4 ENSP00000406046.1 P28340

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Colorectal cancer, susceptibility to, 10 Uncertain:1
Apr 07, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. This variant has not been reported in the literature in individuals affected with POLD1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the POLD1 mRNA. The next in-frame methionine is located at codon 41. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-50902081; API