19-50398824-TCCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGG-T

Variant names:

• chr19-50398824-TCCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGG-T
• NM_002691.4:c.-1-25_16delCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGGC

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_002691.4(POLD1):​c.-1-25_16delCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGGC variant causes a splice acceptor, 5 prime UTR truncation, exon loss, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: POLD1 NM_002691.4 splice_acceptor, 5_prime_UTR_truncation, exon_loss, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.901

Genes affected

POLD1 (HGNC:9175): (DNA polymerase delta 1, catalytic subunit) This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLD1	NM_002691.4	c.-1-25_16delCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGGC	p.Met1fs	frameshift_variant, start_lost, splice_region_variant	Exon 2 of 27	ENST00000440232.7	NP_002682.2
POLD1	NM_002691.4	c.-1-25_16delCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGGC		splice_acceptor_variant, 5_prime_UTR_truncation, exon_loss_variant, splice_region_variant, intron_variant	Exon 2 of 27	ENST00000440232.7	NP_002682.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLD1	ENST00000440232.7	c.-1-26_15delCCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGG	p.Met1fs	frameshift_variant, start_lost, splice_region_variant	Exon 2 of 27	1	NM_002691.4	ENSP00000406046.1
POLD1	ENST00000440232	c.-1-26_15delCCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGG		splice_acceptor_variant, 5_prime_UTR_truncation, exon_loss_variant, splice_region_variant, intron_variant	Exon 2 of 27	1	NM_002691.4	ENSP00000406046.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Colorectal cancer, susceptibility to, 10 Uncertain:1

Apr 07, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. This variant has not been reported in the literature in individuals affected with POLD1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the POLD1 mRNA. The next in-frame methionine is located at codon 41. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-50902081;