chr19-50398824-TCCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGG-T
Variant summary
Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2
The NM_002691.4(POLD1):c.-1-25_16delCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGGC variant causes a splice acceptor, 5 prime UTR truncation, exon loss, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 32)
Consequence
POLD1
NM_002691.4 splice_acceptor, 5_prime_UTR_truncation, exon_loss, splice_region, intron
NM_002691.4 splice_acceptor, 5_prime_UTR_truncation, exon_loss, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.901
Genes affected
POLD1 (HGNC:9175): (DNA polymerase delta 1, catalytic subunit) This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 10 ACMG points.
PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
POLD1 | NM_002691.4 | c.-1-25_16delCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGGC | p.Met1fs | frameshift_variant, start_lost, splice_region_variant | 2/27 | ENST00000440232.7 | NP_002682.2 | |
POLD1 | NM_002691.4 | c.-1-25_16delCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGGC | splice_acceptor_variant, 5_prime_UTR_truncation, exon_loss_variant, splice_region_variant, intron_variant | 2/27 | ENST00000440232.7 | NP_002682.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
POLD1 | ENST00000440232.7 | c.-1-26_15delCCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGG | p.Met1fs | frameshift_variant, start_lost, splice_region_variant | 2/27 | 1 | NM_002691.4 | ENSP00000406046.1 | ||
POLD1 | ENST00000440232 | c.-1-26_15delCCACCAAGCTCCAACTTGCCCAGCAGGATGGATGGCAAGCGG | splice_acceptor_variant, 5_prime_UTR_truncation, exon_loss_variant, splice_region_variant, intron_variant | 2/27 | 1 | NM_002691.4 | ENSP00000406046.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Colorectal cancer, susceptibility to, 10 Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Apr 07, 2023 | In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. This variant has not been reported in the literature in individuals affected with POLD1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the POLD1 mRNA. The next in-frame methionine is located at codon 41. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.