19-50403126-G-GCCCTTCCTACGCCTGGCGCTCA
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_002691.4(POLD1):c.1049_1070dupTCCTACGCCTGGCGCTCACCCT(p.Arg358ProfsTer284) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. L357L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002691.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- POLD1-related polyposis and colorectal cancer syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- colorectal cancer, susceptibility to, 10Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
- mandibular hypoplasia-deafness-progeroid syndromeInheritance: AD, AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, Orphanet, G2P
- Polymerase proofreading-related adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- immunodeficiency 120Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
- non-severe combined immunodeficiency due to polymerase delta deficiencyInheritance: AR Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002691.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLD1 | NM_002691.4 | MANE Select | c.1049_1070dupTCCTACGCCTGGCGCTCACCCT | p.Arg358ProfsTer284 | frameshift | Exon 9 of 27 | NP_002682.2 | ||
| POLD1 | NM_001308632.1 | c.1049_1070dupTCCTACGCCTGGCGCTCACCCT | p.Arg358ProfsTer310 | frameshift | Exon 8 of 26 | NP_001295561.1 | |||
| POLD1 | NM_001256849.1 | c.1049_1070dupTCCTACGCCTGGCGCTCACCCT | p.Arg358ProfsTer284 | frameshift | Exon 9 of 27 | NP_001243778.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLD1 | ENST00000440232.7 | TSL:1 MANE Select | c.1049_1070dupTCCTACGCCTGGCGCTCACCCT | p.Arg358ProfsTer284 | frameshift | Exon 9 of 27 | ENSP00000406046.1 | ||
| POLD1 | ENST00000595904.6 | TSL:1 | c.1049_1070dupTCCTACGCCTGGCGCTCACCCT | p.Arg358ProfsTer310 | frameshift | Exon 9 of 27 | ENSP00000472445.1 | ||
| POLD1 | ENST00000599857.7 | TSL:1 | c.1049_1070dupTCCTACGCCTGGCGCTCACCCT | p.Arg358ProfsTer284 | frameshift | Exon 9 of 27 | ENSP00000473052.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Colorectal cancer, susceptibility to, 10 Uncertain:1
This sequence change creates a premature translational stop signal (p.Arg358Profs*284) in the POLD1 gene. It is expected to result in an absent or disrupted protein product. However, the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in POLD1 cause disease. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 412518). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at