19-54174107-G-GGGGCTGCCCCCACCTAAAGCCAGCCCCAGCCCCA

Position:

• chr19-54174107-G-GGGGCTGCCCCCACCTAAAGCCAGCCCCAGCCCCA

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_024298.5(MBOAT7):​c.1322_1355dupTGGGGCTGGGGCTGGCTTTAGGTGGGGGCAGCCC​(p.Ser453fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MBOAT7 NM_024298.5 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.952

Genes affected

MBOAT7 (HGNC:15505): (membrane bound O-acyltransferase domain containing 7) This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an acyl donor. This protein is involved in the reacylation of phospholipids as part of the phospholipid remodeling pathway known as the Land cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0451 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MBOAT7	NM_024298.5	c.1322_1355dupTGGGGCTGGGGCTGGCTTTAGGTGGGGGCAGCCC	p.Ser453fs	frameshift_variant	8/8	ENST00000245615.6	NP_077274.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MBOAT7	ENST00000245615.6	c.1322_1355dupTGGGGCTGGGGCTGGCTTTAGGTGGGGGCAGCCC	p.Ser453fs	frameshift_variant	8/8	1	NM_024298.5	ENSP00000245615.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000206 AC: 3 AN: 1454462 Hom.: 0 Cov.: 31 AF XY: 0.00000138 AC XY: 1 AN XY: 723542

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000270

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Mar 26, 2021

Not observed in large population cohorts (Lek et al., 2016); Frameshift variant predicted to result in protein truncation as the last 20 amino acids are replaced with 73 different amino acids, although loss-of-function variants have not been reported downstream of this position in the protein; Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-54677801;