19-56814187-TTGGCTCAGCAGCCTCCACTTCTGGCTCAGCAGCCTCCACTTC-TTGGCTCAGCAGCCTCCACTTCTGGCTCAGCAGCCTCCACTTCTGGCTCAGCAGCCTCCACTTC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_006210.3(PEG3):c.4234_4254dupGAAGTGGAGGCTGCTGAGCCA(p.Pro1418_Asn1419insGluValGluAlaAlaGluPro) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000279 in 1,613,404 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_006210.3 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_006210.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PEG3 | NM_006210.3 | MANE Select | c.4234_4254dupGAAGTGGAGGCTGCTGAGCCA | p.Pro1418_Asn1419insGluValGluAlaAlaGluPro | conservative_inframe_insertion | Exon 10 of 10 | NP_006201.1 | Q9GZU2-1 | |
| ZIM2 | NM_001387356.1 | MANE Select | c.490+3538_490+3558dupGAAGTGGAGGCTGCTGAGCCA | intron | N/A | NP_001374285.1 | A0A8I5KWX0 | ||
| PEG3 | NM_001369717.1 | c.4240_4260dupGAAGTGGAGGCTGCTGAGCCA | p.Pro1420_Asn1421insGluValGluAlaAlaGluPro | conservative_inframe_insertion | Exon 9 of 9 | NP_001356646.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PEG3 | ENST00000326441.15 | TSL:1 MANE Select | c.4234_4254dupGAAGTGGAGGCTGCTGAGCCA | p.Pro1418_Asn1419insGluValGluAlaAlaGluPro | conservative_inframe_insertion | Exon 10 of 10 | ENSP00000326581.7 | Q9GZU2-1 | |
| PEG3 | ENST00000599534.5 | TSL:1 | c.4234_4254dupGAAGTGGAGGCTGCTGAGCCA | p.Pro1418_Asn1419insGluValGluAlaAlaGluPro | conservative_inframe_insertion | Exon 7 of 7 | ENSP00000472395.1 | Q9GZU2-1 | |
| PEG3 | ENST00000599577.5 | TSL:1 | c.4234_4254dupGAAGTGGAGGCTGCTGAGCCA | p.Pro1418_Asn1419insGluValGluAlaAlaGluPro | conservative_inframe_insertion | Exon 9 of 9 | ENSP00000469486.1 | Q9GZU2-1 |
Frequencies
GnomAD3 genomes AF: 0.0000658 AC: 10AN: 151952Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000319 AC: 8AN: 250696 AF XY: 0.0000148 show subpopulations
GnomAD4 exome AF: 0.0000240 AC: 35AN: 1461332Hom.: 0 Cov.: 34 AF XY: 0.0000220 AC XY: 16AN XY: 726916 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000658 AC: 10AN: 152072Hom.: 0 Cov.: 32 AF XY: 0.0000538 AC XY: 4AN XY: 74334 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at