rs754092967

Variant names:

• chr19-56814187-TTGGCTCAGCAGCCTCCACTTCTGGCTCAGCAGCCTCCACTTC-T
• rs754092967
• NM_006210.3:c.4213_4254delGAAGTGGAGGCTGCTGAGCCAGAAGTGGAGGCTGCTGAGCCA

Your query was ambiguous. Multiple possible variants found:

• chr19-56814187-TTGGCTCAGCAGCCTCCACTTCTGGCTCAGCAGCCTCCACTTC-T
• chr19-56814187-TTGGCTCAGCAGCCTCCACTTCTGGCTCAGCAGCCTCCACTTC-TTGGCTCAGCAGCCTCCACTTC
• chr19-56814187-TTGGCTCAGCAGCCTCCACTTCTGGCTCAGCAGCCTCCACTTC-TTGGCTCAGCAGCCTCCACTTCTGGCTCAGCAGCCTCCACTTCTGGCTCAGCAGCCTCCACTTC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_006210.3(PEG3):​c.4213_4254delGAAGTGGAGGCTGCTGAGCCAGAAGTGGAGGCTGCTGAGCCA​(p.Glu1405_Pro1418del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,332 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: PEG3 NM_006210.3 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.988
• Publications: 0 publications found

Genes affected

PEG3 (HGNC:8826): (paternally expressed 3) In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2009]

ZIM2 (HGNC:12875): (zinc finger imprinted 2) In human, ZIM2 and PEG3 (GeneID:5178) are two distinct genes that share a set of 5' exons and have a common promoter, and both genes are paternally expressed. Alternative splicing events connect the shared exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. This is in contrast to mouse and cow, where ZIM2 and PEG3 genes do not share exons in common, and the imprinting status of ZIM2 is also not conserved amongst mammals. Additional 5' alternatively spliced transcripts encoding the same protein have been found for the human ZIM2 gene. [provided by RefSeq, Oct 2010]

ENSG00000286125 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006210.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006210.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PEG3	NM_006210.3	MANE Select	c.4213_4254delGAAGTGGAGGCTGCTGAGCCAGAAGTGGAGGCTGCTGAGCCA	p.Glu1405_Pro1418del	conservative_inframe_deletion	Exon 10 of 10	NP_006201.1	Q9GZU2-1
	ZIM2	NM_001387356.1	MANE Select	c.490+3517_490+3558delGAAGTGGAGGCTGCTGAGCCAGAAGTGGAGGCTGCTGAGCCA		intron	N/A	NP_001374285.1	A0A8I5KWX0
	PEG3	NM_001369717.1		c.4219_4260delGAAGTGGAGGCTGCTGAGCCAGAAGTGGAGGCTGCTGAGCCA	p.Glu1407_Pro1420del	conservative_inframe_deletion	Exon 9 of 9	NP_001356646.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PEG3	ENST00000326441.15	TSL:1 MANE Select	c.4213_4254delGAAGTGGAGGCTGCTGAGCCAGAAGTGGAGGCTGCTGAGCCA	p.Glu1405_Pro1418del	conservative_inframe_deletion	Exon 10 of 10	ENSP00000326581.7	Q9GZU2-1
	PEG3	ENST00000599534.5	TSL:1	c.4213_4254delGAAGTGGAGGCTGCTGAGCCAGAAGTGGAGGCTGCTGAGCCA	p.Glu1405_Pro1418del	conservative_inframe_deletion	Exon 7 of 7	ENSP00000472395.1	Q9GZU2-1
	PEG3	ENST00000599577.5	TSL:1	c.4213_4254delGAAGTGGAGGCTGCTGAGCCAGAAGTGGAGGCTGCTGAGCCA	p.Glu1405_Pro1418del	conservative_inframe_deletion	Exon 9 of 9	ENSP00000469486.1	Q9GZU2-1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000399 AC: 1 AN: 250696 AF XY: 0.00000738

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000544

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461332 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726916

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.00 AC: 0 AN: 44698

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26122

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39692

South Asian (SAS) AF: 0.00 AC: 0 AN: 86024

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53336

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111852

Other (OTH) AF: 0.00 AC: 0 AN: 60364

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.99

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs754092967; hg19: chr19-57325555;