2-101698171-GGGCAGCC-GGGCAGCCGGCAGCCGGCAGCCGGCAGCC

Variant names:

• chr2-101698171-G-GGGCAGCCGGCAGCCGGCAGCC
• rs572189095
• NM_001395002.1:c.57+37_57+57dupCAGCCGGCAGCCGGCAGCCGG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_001395002.1(MAP4K4):​c.57+37_57+57dupCAGCCGGCAGCCGGCAGCCGG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000146 in 959,302 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000070 (0 hom., cov: 22)
  • Exomes 𝑓: 0.000016 (0 hom.)
• Consequence: MAP4K4 NM_001395002.1 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.225

Genes affected

MAP4K4 (HGNC:6866): (mitogen-activated protein kinase kinase kinase kinase 4) The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAdExome4 at 13 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MAP4K4	NM_001395002.1	c.57+37_57+57dupCAGCCGGCAGCCGGCAGCCGG		intron_variant	Intron 1 of 32	ENST00000324219.9	NP_001381931.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MAP4K4	ENST00000324219.9	c.57+34_57+35insGGCAGCCGGCAGCCGGCAGCC		intron_variant	Intron 1 of 32	5	NM_001395002.1	ENSP00000313644.6

Frequencies

GnomAD3 genomes AF: 0.00000697 AC: 1 AN: 143522 Hom.: 0 Cov.: 22

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000209

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000159 AC: 13 AN: 815780 Hom.: 0 Cov.: 13 AF XY: 0.0000151 AC XY: 6 AN XY: 396908

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000174

Gnomad4 OTH exome AF: 0.0000363

GnomAD4 genome AF: 0.00000697 AC: 1 AN: 143522 Hom.: 0 Cov.: 22 AF XY: 0.0000143 AC XY: 1 AN XY: 69752

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000209

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs572189095; hg19: chr2-102314633;