2-111898787-TGGCGTAGAGGTGAGTGCGCCC-T

Variant names:

• chr2-111898787-TGGCGTAGAGGTGAGTGCGCCC-T
• NM_006343.3:c.56_61+15delGTAGAGGTGAGTGCGCCCGGC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_006343.3(MERTK):​c.56_61+15delGTAGAGGTGAGTGCGCCCGGC​(p.Arg19_Ala21delinsPro) variant causes a splice donor, disruptive inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: MERTK NM_006343.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.45

Genes affected

MERTK (HGNC:7027): (MER proto-oncogene, tyrosine kinase) This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-111898787-TGGCGTAGAGGTGAGTGCGCCC-T is Pathogenic according to our data. Variant chr2-111898787-TGGCGTAGAGGTGAGTGCGCCC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1333384.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MERTK	NM_006343.3	c.56_61+15delGTAGAGGTGAGTGCGCCCGGC	p.Arg19_Ala21delinsPro	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 1 of 19	ENST00000295408.9	NP_006334.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MERTK	ENST00000295408.9	c.53_61+12delGGCGTAGAGGTGAGTGCGCCC	p.Trp18_Ala21delinsSer	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 1 of 19	1	NM_006343.3	ENSP00000295408.4

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Retinitis pigmentosa 38 Pathogenic:1

Jan 03, 2022

3billion, Medical Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Canonical splice site: predicted to alter splicing and result in a loss or disruption of normal protein function through protein truncation. Multiple pathogenic variants are reported in the predicted truncated region (PVS1_VS).It is not observed in the gnomAD v2.1.1 dataset (PM2_M). Therefore, this variant is classified as likely pathogenic according to the recommendation of ACMG/AMP guideline. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-112656364;