2-118846520-T-TGCGGCCGCCGCCGCCGCCGCCACTGCCGCC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_001426.4(EN1):c.618_647dupGGCGGCAGTGGCGGCGGCGGCGGCGGCCGC(p.Ala216_Ala217insAlaAlaValAlaAlaAlaAlaAlaAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000671 in 148,966 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001426.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- ENDOVE syndrome, limb-only typeInheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001426.4. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes AF: 0.00000672 AC: 1AN: 148858Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000614 AC: 7AN: 1139832Hom.: 0 Cov.: 29 AF XY: 0.0000109 AC XY: 6AN XY: 549034 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000671 AC: 1AN: 148966Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 72644 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.