rs756983158

Variant names:

• chr2-118846520-TGCGGCCGCCGCCGCCGCCGCCACTGCCGCC-T
• rs756983158
• NM_001426.4:c.618_647delGGCGGCAGTGGCGGCGGCGGCGGCGGCCGC

Your query was ambiguous. Multiple possible variants found:

• chr2-118846520-TGCGGCCGCCGCCGCCGCCGCCACTGCCGCC-T
• chr2-118846520-TGCGGCCGCCGCCGCCGCCGCCACTGCCGCC-TGCGGCCGCCGCCGCCGCCGCCACTGCCGCCGCGGCCGCCGCCGCCGCCGCCACTGCCGCC

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 2P and 6B. PM4 BP6_Moderate BS2

The NM_001426.4(EN1):​c.618_647delGGCGGCAGTGGCGGCGGCGGCGGCGGCCGC​(p.Ala207_Ala216del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00226 in 1,288,790 control chromosomes in the GnomAD database, including 85 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0016 (2 hom., cov: 32)
  • Exomes 𝑓: 0.0023 (83 hom.)
• Consequence: EN1 NM_001426.4 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 4.33
• Publications: 0 publications found

Genes affected

EN1 (HGNC:3342): (engrailed homeobox 1) Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]

EN1 Gene-Disease associations (from GenCC):

• ENDOVE syndrome, limb-only type

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001426.4.
• BP6: Variant 2-118846520-TGCGGCCGCCGCCGCCGCCGCCACTGCCGCC-T is Benign according to our data. Variant chr2-118846520-TGCGGCCGCCGCCGCCGCCGCCACTGCCGCC-T is described in ClinVar as Likely_benign. ClinVar VariationId is 3025150.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAd4 at 2 Unknown gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001426.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EN1	NM_001426.4	MANE Select	c.618_647delGGCGGCAGTGGCGGCGGCGGCGGCGGCCGC	p.Ala207_Ala216del	disruptive_inframe_deletion	Exon 1 of 2	NP_001417.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EN1	ENST00000295206.7	TSL:2 MANE Select	c.618_647delGGCGGCAGTGGCGGCGGCGGCGGCGGCCGC	p.Ala207_Ala216del	disruptive_inframe_deletion	Exon 1 of 2	ENSP00000295206.5	Q05925

Frequencies

GnomAD3 genomes AF: 0.00160 AC: 238 AN: 148858 Hom.: 2 Cov.: 32

Gnomad AFR AF: 0.00221

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000535

Gnomad ASJ AF: 0.00850

Gnomad EAS AF: 0.000390

Gnomad SAS AF: 0.000415

Gnomad FIN AF: 0.000528

Gnomad MID AF: 0.00637

Gnomad NFE AF: 0.00144

Gnomad OTH AF: 0.00147

GnomAD2 exomes AF: 0.00106 AC: 53 AN: 50024 AF XY: 0.000963

Gnomad AFR exome AF: 0.00128

Gnomad AMR exome AF: 0.000764

Gnomad ASJ exome AF: 0.00213

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.000156

Gnomad NFE exome AF: 0.00141

Gnomad OTH exome AF: 0.00223

GnomAD4 exome AF: 0.00234 AC: 2670 AN: 1139824 Hom.: 83 AF XY: 0.00235 AC XY: 1288 AN XY: 549030

African (AFR) AF: 0.00223 AC: 53 AN: 23812

American (AMR) AF: 0.000934 AC: 12 AN: 12854

Ashkenazi Jewish (ASJ) AF: 0.00831 AC: 148 AN: 17804

East Asian (EAS) AF: 0.000379 AC: 10 AN: 26376

South Asian (SAS) AF: 0.00271 AC: 88 AN: 32492

European-Finnish (FIN) AF: 0.000825 AC: 25 AN: 30306

Middle Eastern (MID) AF: 0.000286 AC: 1 AN: 3502

European-Non Finnish (NFE) AF: 0.00234 AC: 2220 AN: 947296

Other (OTH) AF: 0.00249 AC: 113 AN: 45382

GnomAD4 genome AF: 0.00160 AC: 238 AN: 148966 Hom.: 2 Cov.: 32 AF XY: 0.00154 AC XY: 112 AN XY: 72644

African (AFR) AF: 0.00221 AC: 91 AN: 41220

American (AMR) AF: 0.000534 AC: 8 AN: 14982

Ashkenazi Jewish (ASJ) AF: 0.00850 AC: 29 AN: 3410

East Asian (EAS) AF: 0.000391 AC: 2 AN: 5116

South Asian (SAS) AF: 0.000415 AC: 2 AN: 4818

European-Finnish (FIN) AF: 0.000528 AC: 5 AN: 9474

Middle Eastern (MID) AF: 0.00685 AC: 2 AN: 292

European-Non Finnish (NFE) AF: 0.00144 AC: 96 AN: 66678

Other (OTH) AF: 0.00145 AC: 3 AN: 2064

Alfa AF: 0.00196 Hom.: 0

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.3
Mutation Taster		=187/13	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs756983158; hg19: chr2-119604096;