2-148021483-GCTGCTGCTGCTGCTACTGCTGCTGCTGCTA-GCTGCTGCTGCTGCTACTGCTGCTGCTGCTACTGCTGCTGCTGCTACTGCTGCTGCTGCTA
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001378120.1(MBD5):c.-1114_-1085dupGCTACTGCTGCTGCTGCTACTGCTGCTGCT variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000066 in 151,456 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001378120.1 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- Meier-Gorlin syndrome 2Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
- Meier-Gorlin syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MBD5 | NM_001378120.1 | c.-1114_-1085dupGCTACTGCTGCTGCTGCTACTGCTGCTGCT | 5_prime_UTR_variant | Exon 1 of 14 | ENST00000642680.2 | NP_001365049.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MBD5 | ENST00000642680.2 | c.-1114_-1085dupGCTACTGCTGCTGCTGCTACTGCTGCTGCT | 5_prime_UTR_variant | Exon 1 of 14 | NM_001378120.1 | ENSP00000493871.2 |
Frequencies
GnomAD3 genomes AF: 0.00000660 AC: 1AN: 151456Hom.: 0 Cov.: 29 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000724 AC: 3AN: 414108Hom.: 1 Cov.: 0 AF XY: 0.00000436 AC XY: 1AN XY: 229146 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.00000660 AC: 1AN: 151456Hom.: 0 Cov.: 29 AF XY: 0.0000135 AC XY: 1AN XY: 73964 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at