chr2-148021483-G-GCTGCTGCTGCTGCTACTGCTGCTGCTGCTA

Variant names:

• chr2-148021483-G-GCTGCTGCTGCTGCTACTGCTGCTGCTGCTA
• NM_001378120.1:c.-1114_-1085dupGCTACTGCTGCTGCTGCTACTGCTGCTGCT

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001378120.1(MBD5):​c.-1114_-1085dupGCTACTGCTGCTGCTGCTACTGCTGCTGCT variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000066 in 151,456 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 29)
  • Exomes 𝑓: 0.0000072 (1 hom.)
  • Failed GnomAD Quality Control
• Consequence: MBD5 NM_001378120.1 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.437

Genes affected

MBD5 (HGNC:20444): (methyl-CpG binding domain protein 5) This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause an autosomal dominant type of cognitive disability. The encoded protein interacts with the polycomb repressive complex PR-DUB which catalyzes the deubiquitination of a lysine residue of histone 2A. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Jul 2017]

ORC4 (HGNC:8490): (origin recognition complex subunit 4) The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MBD5	NM_001378120.1	c.-1114_-1085dupGCTACTGCTGCTGCTGCTACTGCTGCTGCT		5_prime_UTR_variant	Exon 1 of 14	ENST00000642680.2	NP_001365049.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MBD5	ENST00000642680	c.-1114_-1085dupGCTACTGCTGCTGCTGCTACTGCTGCTGCT		5_prime_UTR_variant	Exon 1 of 14		NM_001378120.1	ENSP00000493871.2

Frequencies

GnomAD3 genomes AF: 0.00000660 AC: 1 AN: 151456 Hom.: 0 Cov.: 29

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000724 AC: 3 AN: 414108 Hom.: 1 Cov.: 0 AF XY: 0.00000436 AC XY: 1 AN XY: 229146

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000133

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000660 AC: 1 AN: 151456 Hom.: 0 Cov.: 29 AF XY: 0.0000135 AC XY: 1 AN XY: 73964

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000147

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-148779052;