2-157737326-TGCCCAGTTCACAGTCATCGAGCGAGGTTAGGGTGGTTTTGATGTCTCCCCAACACATGGCTGGGTACGACGTCTGCCTTGTCAAAGCAGCCATTTGGGGAGGGAGACAGATGGATTCCATTCTGACAACCAGTCAGGCCAGCATTAGGTCCCAGCTGGACAATGACAACAACGTCAAATCTTCCTTCTTGACACTATGAAAATGTCAACAGTCAGTTTTCAATTTGTCGAGGGAATTATCAATTTTGGTCAAAGTCTTTTTGATACGCAGTGCTGTGAGTCTTGCGGATG-T

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001111067.4(ACVR1):c.1445_*204del variant causes a stop lost, 3 prime UTR change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ACVR1 NM_001111067.4 stop_lost, 3_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.13

Genes affected

ACVR1 (HGNC:171): (activin A receptor type 1) Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
ACVR1	NM_001111067.4	c.1445_*204del		stop_lost, 3_prime_UTR_variant	11/11	ENST00000434821.7

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
ACVR1	ENST00000434821.7	c.1445_*204del		stop_lost, 3_prime_UTR_variant	11/11	1	NM_001111067.4	P4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Nov 01, 2022

This sequence change creates a premature translational stop signal (p.Pro482Hisfs*11) in the ACVR1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 28 amino acid(s) of the ACVR1 protein. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with ACVR1-related conditions. This variant is not present in population databases (gnomAD no frequency). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-158593838;