2-157737326-TGCCCAGTTCACAGTCATCGAGCGAGGTTAGGGTGGTTTTGATGTCTCCCCAACACATGGCTGGGTACGACGTCTGCCTTGTCAAAGCAGCCATTTGGGGAGGGAGACAGATGGATTCCATTCTGACAACCAGTCAGGCCAGCATTAGGTCCCAGCTGGACAATGACAACAACGTCAAATCTTCCTTCTTGACACTATGAAAATGTCAACAGTCAGTTTTCAATTTGTCGAGGGAATTATCAATTTTGGTCAAAGTCTTTTTGATACGCAGTGCTGTGAGTCTTGCGGATG-T
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_001111067.4(ACVR1):c.1445_*204del variant causes a stop lost, 3 prime UTR change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 32)
Consequence
ACVR1
NM_001111067.4 stop_lost, 3_prime_UTR
NM_001111067.4 stop_lost, 3_prime_UTR
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 5.13
Genes affected
ACVR1 (HGNC:171): (activin A receptor type 1) Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 4 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PM4
Stoplost variant in NM_001111067.4
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | UniProt |
---|---|---|---|---|---|---|---|
ACVR1 | NM_001111067.4 | c.1445_*204del | stop_lost, 3_prime_UTR_variant | 11/11 | ENST00000434821.7 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|
ACVR1 | ENST00000434821.7 | c.1445_*204del | stop_lost, 3_prime_UTR_variant | 11/11 | 1 | NM_001111067.4 | P4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not provided Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Nov 01, 2022 | This sequence change creates a premature translational stop signal (p.Pro482Hisfs*11) in the ACVR1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 28 amino acid(s) of the ACVR1 protein. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with ACVR1-related conditions. This variant is not present in population databases (gnomAD no frequency). - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.