2-166041206-CACATTTACCTTCCAATATGCTT-C
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001165963.4(SCN1A):c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001165963.4 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| SCN1A | ENST00000674923.1 | c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT | splice_region_variant, intron_variant | Intron 16 of 28 | NM_001165963.4 | ENSP00000501589.1 | ||||
| SCN1A | ENST00000303395.9 | c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT | splice_region_variant, intron_variant | Intron 15 of 27 | 5 | ENSP00000303540.4 | ||||
| SCN1A | ENST00000375405.7 | c.2382+3_2382+24delAAGCATATTGGAAGGTAAATGT | splice_region_variant, intron_variant | Intron 13 of 25 | 5 | ENSP00000364554.3 | ||||
| SCN1A | ENST00000409050.2 | c.2331+3_2331+24delAAGCATATTGGAAGGTAAATGT | splice_region_variant, intron_variant | Intron 15 of 27 | 5 | ENSP00000386312.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Developmental and epileptic encephalopathy Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Nucleotide substitutions within the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with SCN1A-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change falls in intron 13 of the SCN1A gene. It does not directly change the encoded amino acid sequence of the SCN1A protein, but it affects a nucleotide within the consensus splice site of the intron. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at