2-166041206-CACATTTACCTTCCAATATGCTT-C
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate
The NM_001353961.2(SCN1A):c.-41_-28+8delAAGCATATTGGAAGGTAAATGT variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). The gene SCN1A is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_001353961.2 splice_donor, splice_region, 5_prime_UTR, intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001353961.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SCN1A | MANE Select | c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT | splice_region intron | N/A | NP_001159435.1 | P35498-1 | |||
| SCN1A | c.-41_-28+8delAAGCATATTGGAAGGTAAATGT | splice_region | Exon 15 of 28 | NP_001340890.1 | |||||
| SCN1A | c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT | splice_region intron | N/A | NP_001189364.1 | P35498-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SCN1A | MANE Select | c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT | splice_region intron | N/A | ENSP00000501589.1 | P35498-1 | |||
| SCN1A | TSL:5 | c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT | splice_region intron | N/A | ENSP00000303540.4 | P35498-1 | |||
| SCN1A | TSL:5 | c.2382+3_2382+24delAAGCATATTGGAAGGTAAATGT | splice_region intron | N/A | ENSP00000364554.3 | P35498-2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at