rs1553543127

Variant names:

• chr2-166041206-CACATTTACCTTCCAATATGCTT-C
• rs1553543127
• NM_001165963.4:c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_001353961.2(SCN1A):​c.-41_-28+8delAAGCATATTGGAAGGTAAATGT variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SCN1A NM_001353961.2 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.40
• Publications: 0 publications found

Genes affected

SCN1A (HGNC:10585): (sodium voltage-gated channel alpha subunit 1) Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]

SCN1A-AS1 (HGNC:54069): (SCN1A and SCN9A antisense RNA 1)

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.07107023 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001353961.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SCN1A	NM_001165963.4	MANE Select	c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT		splice_region intron	N/A	NP_001159435.1
	SCN1A	NM_001353961.2		c.-41_-28+8delAAGCATATTGGAAGGTAAATGT		splice_region	Exon 15 of 28	NP_001340890.1
	SCN1A	NM_001202435.3		c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT		splice_region intron	N/A	NP_001189364.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SCN1A	ENST00000674923.1	MANE Select	c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT		splice_region intron	N/A	ENSP00000501589.1
	SCN1A	ENST00000303395.9	TSL:5	c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT		splice_region intron	N/A	ENSP00000303540.4
	SCN1A	ENST00000375405.7	TSL:5	c.2382+3_2382+24delAAGCATATTGGAAGGTAAATGT		splice_region intron	N/A	ENSP00000364554.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Developmental and epileptic encephalopathy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553543127; hg19: chr2-166897716;