rs1553543127

Variant names:

• chr2-166041206-CACATTTACCTTCCAATATGCTT-C
• rs1553543127
• NM_001165963.4:c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_001353961.2(SCN1A):​c.-41_-28+8delAAGCATATTGGAAGGTAAATGT variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SCN1A NM_001353961.2 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.40

Genes affected

SCN1A (HGNC:10585): (sodium voltage-gated channel alpha subunit 1) Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]

SCN1A-AS1 (HGNC:54069): (SCN1A and SCN9A antisense RNA 1)

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.07107023 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SCN1A	NM_001165963.4	c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT		splice_region_variant, intron_variant	Intron 16 of 28	ENST00000674923.1	NP_001159435.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SCN1A	ENST00000674923.1	c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT		splice_region_variant, intron_variant	Intron 16 of 28		NM_001165963.4	ENSP00000501589.1
SCN1A	ENST00000303395.9	c.2415+3_2415+24delAAGCATATTGGAAGGTAAATGT		splice_region_variant, intron_variant	Intron 15 of 27	5		ENSP00000303540.4
SCN1A	ENST00000375405.7	c.2382+3_2382+24delAAGCATATTGGAAGGTAAATGT		splice_region_variant, intron_variant	Intron 13 of 25	5		ENSP00000364554.3
SCN1A	ENST00000409050.1	c.2331+3_2331+24delAAGCATATTGGAAGGTAAATGT		splice_region_variant, intron_variant	Intron 13 of 25	5		ENSP00000386312.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Early infantile epileptic encephalopathy with suppression bursts Uncertain:1

Feb 14, 2020

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Nucleotide substitutions within the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with SCN1A-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change falls in intron 13 of the SCN1A gene. It does not directly change the encoded amino acid sequence of the SCN1A protein, but it affects a nucleotide within the consensus splice site of the intron. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553543127; hg19: chr2-166897716;