2-171785280-AGTGGCTGCCACTGCTGCCTTTGGCTGAACCACAGCAACACTAGGAGACTTAAATTTCGGGAGATAAAGGCCAAATTTGTTTTCGATGCCTGCAAAC-A

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_003705.5(SLC25A12):c.1935_2030del(p.Phe646_Thr677del) variant causes a inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T645T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: SLC25A12 NM_003705.5 inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.18

Genes affected

SLC25A12 (HGNC:10982): (solute carrier family 25 member 12) This gene encodes a calcium-binding mitochondrial carrier protein. The encoded protein localizes to the mitochondria and is involved in the exchange of aspartate for glutamate across the inner mitochondrial membrane. Polymorphisms in this gene may be associated with autism, and mutations in this gene may also be a cause of global cerebral hypomyelination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_003705.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
SLC25A12	NM_003705.5	c.1935_2030del	p.Phe646_Thr677del	inframe_deletion	18/18	ENST00000422440.7
SLC25A12	XM_047446142.1	c.1662_1757del	p.Phe555_Thr586del	inframe_deletion	16/16
SLC25A12	NR_047549.2	n.1849_1944del		non_coding_transcript_exon_variant	17/17

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
SLC25A12	ENST00000422440.7	c.1935_2030del	p.Phe646_Thr677del	inframe_deletion	18/18	1	NM_003705.5	P1
SLC25A12	ENST00000472070.1	n.1345_1440del		non_coding_transcript_exon_variant	3/3	2
SLC25A12	ENST00000263812.8	c.*1555_*1650del		3_prime_UTR_variant, NMD_transcript_variant	17/17	2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Jan 22, 2021

This variant is not present in population databases (ExAC no frequency). This variant, c.1935_2030del, results in the deletion of 32 amino acid(s) of the SLC25A12 protein (p.Phe646_Thr677del), but otherwise preserves the integrity of the reading frame. This variant has not been reported in the literature in individuals with SLC25A12-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-172641790;