2-178677634-TGGCACCTTAGGTTTAACTTCTGGAA-T
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_001267550.2(TTN):c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC(p.Leu11418GlnfsTer42) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001267550.2 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TTN | NM_001267550.2 | MANE Select | c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu11418GlnfsTer42 | frameshift | Exon 146 of 363 | NP_001254479.2 | ||
| TTN | NM_001256850.1 | c.33302_33326delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu11101GlnfsTer13 | frameshift | Exon 144 of 313 | NP_001243779.1 | |||
| TTN | NM_133378.4 | c.30521_30545delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu10174GlnfsTer13 | frameshift | Exon 143 of 312 | NP_596869.4 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TTN | ENST00000589042.5 | TSL:5 MANE Select | c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu11418GlnfsTer42 | frameshift | Exon 146 of 363 | ENSP00000467141.1 | ||
| TTN | ENST00000446966.2 | TSL:1 | c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu11418GlnfsTer42 | frameshift | Exon 146 of 361 | ENSP00000408004.2 | ||
| TTN | ENST00000436599.2 | TSL:1 | c.33977_34001delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu11326GlnfsTer42 | frameshift | Exon 144 of 361 | ENSP00000405517.2 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1
This sequence change creates a premature translational stop signal (p.Leu11418Glnfs*42) in the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with clinical features of autosomal recessive TTN-related conditions (internal data). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 467038). This variant is located in the I band of TTN (PMID: 25589632). Truncating variants in this region have been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875, internal data). Truncating variants in this region have also been identified in individuals affected with autosomal dominant dilated cardiomyopathy and/or cardio-related conditions (PMID: 27869827, 32964742, internal data). For these reasons, this variant has been classified as Pathogenic.
Congenital myopathy Uncertain:1
Primary dilated cardiomyopathy;C0175709:Centronuclear myopathy;C1837342:Autosomal recessive limb-girdle muscular dystrophy type 2J;C1838244:Tibial muscular dystrophy;C1863599:Myopathy, myofibrillar, 9, with early respiratory failure Other:1
Variant classified as Uncertain significance and reported on 03-10-2022 by Invitae. GenomeConnect-InvitaePIN assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at