rs1373610867

Variant names:

• chr2-178677634-TGGCACCTTAGGTTTAACTTCTGGAA-T
• rs1373610867
• NM_001267550.2:c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_001267550.2(TTN):​c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC​(p.Leu11418GlnfsTer42) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: TTN NM_001267550.2 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1 O:1
• Conservation: PhyloP100: 4.82
• Publications: 0 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

LOC124906100 (HGNC:):

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-178677634-TGGCACCTTAGGTTTAACTTCTGGAA-T is Pathogenic according to our data. Variant chr2-178677634-TGGCACCTTAGGTTTAACTTCTGGAA-T is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 467038.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TTN	NM_001267550.2	c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC	p.Leu11418GlnfsTer42	frameshift_variant	Exon 146 of 363	ENST00000589042.5	NP_001254479.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TTN	ENST00000589042.5	c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC	p.Leu11418GlnfsTer42	frameshift_variant	Exon 146 of 363	5	NM_001267550.2	ENSP00000467141.1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

Alfa AF: 0.00 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:1 Other:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1

Jan 21, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Leu11418Glnfs*42) in the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with clinical features of autosomal recessive TTN-related conditions (internal data). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 467038). This variant is located in the I band of TTN (PMID: 25589632). Truncating variants in this region have been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875, internal data). Truncating variants in this region have also been identified in individuals affected with autosomal dominant dilated cardiomyopathy and/or cardio-related conditions (PMID: 27869827, 32964742, internal data). For these reasons, this variant has been classified as Pathogenic.

Congenital myopathy Uncertain:1

Apr 17, 2019

Cambridge Genomics Laboratory, East Genomic Laboratory Hub, NHS Genomic Medicine Service

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Primary dilated cardiomyopathy;C0175709:Centronuclear myopathy;C1837342:Autosomal recessive limb-girdle muscular dystrophy type 2J;C1838244:Tibial muscular dystrophy;C1863599:Myopathy, myofibrillar, 9, with early respiratory failure Other:1

GenomeConnect - Invitae Patient Insights Network

Significance: not provided

Review Status: no classification provided

Collection Method: phenotyping only

Variant classified as Uncertain significance and reported on 03-10-2022 by Invitae. GenomeConnect-InvitaePIN assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information.

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.8
Mutation Taster		=1/199	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1373610867; hg19: chr2-179542361;