rs1373610867
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_001267550.2(TTN):c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC(p.Leu11418GlnfsTer42) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001267550.2 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TTN | MANE Select | c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu11418GlnfsTer42 | frameshift | Exon 146 of 363 | NP_001254479.2 | Q8WZ42-12 | ||
| TTN | c.33302_33326delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu11101GlnfsTer13 | frameshift | Exon 144 of 313 | NP_001243779.1 | Q8WZ42-1 | |||
| TTN | c.30521_30545delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu10174GlnfsTer13 | frameshift | Exon 143 of 312 | NP_596869.4 | Q8WZ42-11 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TTN | TSL:5 MANE Select | c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu11418GlnfsTer42 | frameshift | Exon 146 of 363 | ENSP00000467141.1 | Q8WZ42-12 | ||
| TTN | TSL:1 | c.34253_34277delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu11418GlnfsTer42 | frameshift | Exon 146 of 361 | ENSP00000408004.2 | A0A1B0GXE3 | ||
| TTN | TSL:1 | c.33977_34001delTTCCAGAAGTTAAACCTAAGGTGCC | p.Leu11326GlnfsTer42 | frameshift | Exon 144 of 361 | ENSP00000405517.2 | A0A0C4DG59 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at