2-178677772-TTCAGGTAGAACTTCCTCTTCC-TTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTCC

Variant names:

• chr2-178677772-T-TTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTCC
• rs397517548
• NM_001267550.2:c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001267550.2(TTN):​c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA​(p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000686 in 1,456,780 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. E11380E) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: TTN NM_001267550.2 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.914
• Publications: 1 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

LOC124906100 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001267550.2.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	NM_001267550.2	MANE Select	c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA	p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu	disruptive_inframe_insertion	Exon 146 of 363	NP_001254479.2
	TTN	NM_001256850.1		c.33147_33188dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA	p.Glu11063_Glu11064insGluGluGluValLeuProGluGluGluGluValLeuProGlu	disruptive_inframe_insertion	Exon 144 of 313	NP_001243779.1
	TTN	NM_133378.4		c.30366_30407dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA	p.Glu10136_Glu10137insGluGluGluValLeuProGluGluGluGluValLeuProGlu	disruptive_inframe_insertion	Exon 143 of 312	NP_596869.4

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	ENST00000589042.5	TSL:5 MANE Select	c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA	p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu	disruptive_inframe_insertion	Exon 146 of 363	ENSP00000467141.1
	TTN	ENST00000446966.2	TSL:1	c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA	p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu	disruptive_inframe_insertion	Exon 146 of 361	ENSP00000408004.2
	TTN	ENST00000436599.2	TSL:1	c.33822_33863dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA	p.Glu11288_Glu11289insGluGluGluValLeuProGluGluGluGluValLeuProGlu	disruptive_inframe_insertion	Exon 144 of 361	ENSP00000405517.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000402 AC: 1 AN: 248482 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000887

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.86e-7 AC: 1 AN: 1456780 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 724492

African (AFR) AF: 0.00 AC: 0 AN: 33380

American (AMR) AF: 0.00 AC: 0 AN: 44672

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26098

East Asian (EAS) AF: 0.00 AC: 0 AN: 39624

South Asian (SAS) AF: 0.00 AC: 0 AN: 85406

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53398

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5744

European-Non Finnish (NFE) AF: 9.02e-7 AC: 1 AN: 1108304

Other (OTH) AF: 0.00 AC: 0 AN: 60154

GnomAD4 genome Cov.: 32

Alfa AF: 0.0000480 Hom.: 2

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.91

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397517548; hg19: chr2-179542499;