rs397517548

Variant names:

• chr2-178677772-TTCAGGTAGAACTTCCTCTTCC-T
• rs397517548
• NM_001267550.2:c.34119_34139delGGAAGAGGAAGTTCTACCTGA

Your query was ambiguous. Multiple possible variants found:

• chr2-178677772-TTCAGGTAGAACTTCCTCTTCC-T
• chr2-178677772-TTCAGGTAGAACTTCCTCTTCC-TTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTCC
• chr2-178677772-TTCAGGTAGAACTTCCTCTTCC-TTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTCC

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4 BP6

The NM_001267550.2(TTN):​c.34119_34139delGGAAGAGGAAGTTCTACCTGA​(p.Glu11374_Glu11380del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000125 in 151,720 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. E11373E) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000078 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TTN NM_001267550.2 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:1
• Conservation: PhyloP100: 2.66
• Publications: 1 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

LOC124906100 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001267550.2.
• BP6: Variant 2-178677772-TTCAGGTAGAACTTCCTCTTCC-T is Benign according to our data. Variant chr2-178677772-TTCAGGTAGAACTTCCTCTTCC-T is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 419414.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	NM_001267550.2	MANE Select	c.34119_34139delGGAAGAGGAAGTTCTACCTGA	p.Glu11374_Glu11380del	disruptive_inframe_deletion	Exon 146 of 363	NP_001254479.2
	TTN	NM_001256850.1		c.33168_33188delGGAAGAGGAAGTTCTACCTGA	p.Glu11057_Glu11063del	disruptive_inframe_deletion	Exon 144 of 313	NP_001243779.1
	TTN	NM_133378.4		c.30387_30407delGGAAGAGGAAGTTCTACCTGA	p.Glu10130_Glu10136del	disruptive_inframe_deletion	Exon 143 of 312	NP_596869.4

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	ENST00000589042.5	TSL:5 MANE Select	c.34119_34139delGGAAGAGGAAGTTCTACCTGA	p.Glu11374_Glu11380del	disruptive_inframe_deletion	Exon 146 of 363	ENSP00000467141.1
	TTN	ENST00000446966.2	TSL:1	c.34119_34139delGGAAGAGGAAGTTCTACCTGA	p.Glu11374_Glu11380del	disruptive_inframe_deletion	Exon 146 of 361	ENSP00000408004.2
	TTN	ENST00000436599.2	TSL:1	c.33843_33863delGGAAGAGGAAGTTCTACCTGA	p.Glu11282_Glu11288del	disruptive_inframe_deletion	Exon 144 of 361	ENSP00000405517.2

Frequencies

GnomAD3 genomes AF: 0.000125 AC: 19 AN: 151600 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000193

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000659

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000838

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000886

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000117 AC: 29 AN: 248482 AF XY: 0.000119

Gnomad AFR exome AF: 0.000194

Gnomad AMR exome AF: 0.0000870

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000355

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000776 AC: 113 AN: 1456772 Hom.: 0 AF XY: 0.0000828 AC XY: 60 AN XY: 724486

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33380

American (AMR) AF: 0.0000895 AC: 4 AN: 44672

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26098

East Asian (EAS) AF: 0.0000505 AC: 2 AN: 39622

South Asian (SAS) AF: 0.000539 AC: 46 AN: 85406

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53398

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5744

European-Non Finnish (NFE) AF: 0.0000505 AC: 56 AN: 1108298

Other (OTH) AF: 0.0000831 AC: 5 AN: 60154

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000125 AC: 19 AN: 151720 Hom.: 0 Cov.: 32 AF XY: 0.000121 AC XY: 9 AN XY: 74194

African (AFR) AF: 0.000193 AC: 8 AN: 41474

American (AMR) AF: 0.0000659 AC: 1 AN: 15184

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3464

East Asian (EAS) AF: 0.00 AC: 0 AN: 5162

South Asian (SAS) AF: 0.000838 AC: 4 AN: 4774

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10598

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000886 AC: 6 AN: 67748

Other (OTH) AF: 0.00 AC: 0 AN: 2110

Alfa AF: 0.00 Hom.: 2

ClinVar

ClinVar submissions as Germline

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	1	not provided (2)
-	1	-	Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.7
Mutation Taster		=158/42	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397517548; hg19: chr2-179542499;