2-210477693-A-ATAGTTGCTTTCTTAGGAAATG

Variant names:

• chr2-210477693-A-ATAGTTGCTTTCTTAGGAAATG
• rs1375135144
• ENST00000430249.7:c.-56_-36dupGGAAATGTAGTTGCTTTCTTA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 2P and 2B. PM2 BP6_Moderate

The NM_001122633.3(CPS1):​c.-74_-54dupGGAAATGTAGTTGCTTTCTTA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000131 in 1,600,460 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000013 (0 hom.)
• Consequence: CPS1 NM_001122633.3 5_prime_UTR
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: -0.195

Genes affected

CPS1 (HGNC:2323): (carbamoyl-phosphate synthase 1) The mitochondrial enzyme encoded by this gene catalyzes synthesis of carbamoyl phosphate from ammonia and bicarbonate. This reaction is the first committed step of the urea cycle, which is important in the removal of excess urea from cells. The encoded protein may also represent a core mitochondrial nucleoid protein. Three transcript variants encoding different isoforms have been found for this gene. The shortest isoform may not be localized to the mitochondrion. Mutations in this gene have been associated with carbamoyl phosphate synthetase deficiency, susceptibility to persistent pulmonary hypertension, and susceptibility to venoocclusive disease after bone marrow transplantation.[provided by RefSeq, May 2010]

LANCL1 (HGNC:6508): (LanC like glutathione S-transferase 1) This gene encodes a loosely associated peripheral membrane protein related to the LanC family of bacterial membrane-associated proteins involved in the biosynthesis of antimicrobial peptides. This protein may play a role as a peptide-modifying enzyme component in eukaryotic cells. Previously considered a member of the G-protein-coupled receptor superfamily, this protein is now in the LanC family. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 2-210477693-A-ATAGTTGCTTTCTTAGGAAATG is Benign according to our data. Variant chr2-210477693-A-ATAGTTGCTTTCTTAGGAAATG is described in ClinVar as [Likely_benign]. Clinvar id is 506407.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CPS1	NM_001122633.3	c.-74_-54dupGGAAATGTAGTTGCTTTCTTA		5_prime_UTR_variant	Exon 1 of 39		NP_001116105.2
CPS1	NM_001369257.1	c.-194_-174dupGGAAATGTAGTTGCTTTCTTA		5_prime_UTR_variant	Exon 1 of 40		NP_001356186.1
LANCL1	XM_005246243.3	c.-245_-225dupCATTTCCTAAGAAAGCAACTA		upstream_gene_variant			XP_005246300.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CPS1	ENST00000430249.7	c.-56_-36dupGGAAATGTAGTTGCTTTCTTA		5_prime_UTR_variant	Exon 1 of 39	1		ENSP00000402608.2
CPS1	ENST00000673510.1	c.-194_-174dupGGAAATGTAGTTGCTTTCTTA		5_prime_UTR_variant	Exon 1 of 40			ENSP00000500537.1
CPS1	ENST00000673630.1	c.-308_-288dupGGAAATGTAGTTGCTTTCTTA		5_prime_UTR_variant	Exon 1 of 40			ENSP00000501073.1

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152126 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000483

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000131 AC: 19 AN: 1448334 Hom.: 0 Cov.: 27 AF XY: 0.00000556 AC XY: 4 AN XY: 719884

African (AFR) AF: 0.000150 AC: 5 AN: 33262

American (AMR) AF: 0.0000231 AC: 1 AN: 43304

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25738

East Asian (EAS) AF: 0.00 AC: 0 AN: 39602

South Asian (SAS) AF: 0.00 AC: 0 AN: 83834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52970

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5742

European-Non Finnish (NFE) AF: 0.0000109 AC: 12 AN: 1103958

Other (OTH) AF: 0.0000167 AC: 1 AN: 59924

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152126 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74300

African (AFR) AF: 0.0000483 AC: 2 AN: 41422

American (AMR) AF: 0.00 AC: 0 AN: 15270

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5192

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10598

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68032

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

Jun 28, 2016

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.20

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Loading publications...

Other links and lift over

dbSNP: rs1375135144; hg19: chr2-211342417;