rs1375135144

Variant names:

• chr2-210477693-ATAGTTGCTTTCTTAGGAAATG-A
• rs1375135144
• ENST00000430249.7:c.-56_-36delGGAAATGTAGTTGCTTTCTTA

Your query was ambiguous. Multiple possible variants found:

• chr2-210477693-ATAGTTGCTTTCTTAGGAAATG-A
• chr2-210477693-ATAGTTGCTTTCTTAGGAAATG-ATAGTTGCTTTCTTAGGAAATGTAGTTGCTTTCTTAGGAAATG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001122633.3(CPS1):​c.-74_-54delGGAAATGTAGTTGCTTTCTTA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000276 in 1,448,334 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000028 (0 hom.)
• Consequence: CPS1 NM_001122633.3 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.52
• Publications: 0 publications found

Genes affected

CPS1 (HGNC:2323): (carbamoyl-phosphate synthase 1) The mitochondrial enzyme encoded by this gene catalyzes synthesis of carbamoyl phosphate from ammonia and bicarbonate. This reaction is the first committed step of the urea cycle, which is important in the removal of excess urea from cells. The encoded protein may also represent a core mitochondrial nucleoid protein. Three transcript variants encoding different isoforms have been found for this gene. The shortest isoform may not be localized to the mitochondrion. Mutations in this gene have been associated with carbamoyl phosphate synthetase deficiency, susceptibility to persistent pulmonary hypertension, and susceptibility to venoocclusive disease after bone marrow transplantation.[provided by RefSeq, May 2010]

LANCL1 (HGNC:6508): (LanC like glutathione S-transferase 1) This gene encodes a loosely associated peripheral membrane protein related to the LanC family of bacterial membrane-associated proteins involved in the biosynthesis of antimicrobial peptides. This protein may play a role as a peptide-modifying enzyme component in eukaryotic cells. Previously considered a member of the G-protein-coupled receptor superfamily, this protein is now in the LanC family. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001122633.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CPS1	NM_001122633.3		c.-74_-54delGGAAATGTAGTTGCTTTCTTA		5_prime_UTR	Exon 1 of 39	NP_001116105.2	P31327-1
	CPS1	NM_001369257.1		c.-194_-174delGGAAATGTAGTTGCTTTCTTA		5_prime_UTR	Exon 1 of 40	NP_001356186.1	P31327-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CPS1	ENST00000430249.7	TSL:1	c.-56_-36delGGAAATGTAGTTGCTTTCTTA		5_prime_UTR	Exon 1 of 39	ENSP00000402608.2	P31327-3
	CPS1	ENST00000673510.1		c.-194_-174delGGAAATGTAGTTGCTTTCTTA		5_prime_UTR	Exon 1 of 40	ENSP00000500537.1	P31327-1
	CPS1	ENST00000673630.1		c.-308_-288delGGAAATGTAGTTGCTTTCTTA		5_prime_UTR	Exon 1 of 40	ENSP00000501073.1	P31327-1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000276 AC: 4 AN: 1448334 Hom.: 0 AF XY: 0.00000417 AC XY: 3 AN XY: 719884

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33262

American (AMR) AF: 0.00 AC: 0 AN: 43304

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25738

East Asian (EAS) AF: 0.00 AC: 0 AN: 39602

South Asian (SAS) AF: 0.00 AC: 0 AN: 83834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52970

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5742

European-Non Finnish (NFE) AF: 0.00000362 AC: 4 AN: 1103958

Other (OTH) AF: 0.00 AC: 0 AN: 59924

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000286652), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1375135144; hg19: chr2-211342417;