2-210477693-ATAGTTGCTTTCTTAGGAAATG-ATAGTTGCTTTCTTAGGAAATGTAGTTGCTTTCTTAGGAAATG
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate
The NM_001122633.3(CPS1):c.-74_-54dupGGAAATGTAGTTGCTTTCTTA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000131 in 1,600,460 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_001122633.3 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001122633.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CPS1 | TSL:1 | c.-56_-36dupGGAAATGTAGTTGCTTTCTTA | 5_prime_UTR | Exon 1 of 39 | ENSP00000402608.2 | P31327-3 | |||
| CPS1 | c.-194_-174dupGGAAATGTAGTTGCTTTCTTA | 5_prime_UTR | Exon 1 of 40 | ENSP00000500537.1 | P31327-1 | ||||
| CPS1 | c.-308_-288dupGGAAATGTAGTTGCTTTCTTA | 5_prime_UTR | Exon 1 of 40 | ENSP00000501073.1 | P31327-1 |
Frequencies
GnomAD3 genomes AF: 0.0000131 AC: 2AN: 152126Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 0.0000131 AC: 19AN: 1448334Hom.: 0 Cov.: 27 AF XY: 0.00000556 AC XY: 4AN XY: 719884 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000131 AC: 2AN: 152126Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1AN XY: 74300 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.