2-24793181-GGGTGGTCGCGGTGAGTGTGCAAGGCCGC-GGGTGGTCGCGGTGAGTGTGCAAGGCCGCGGTGGTCGCGGTGAGTGTGCAAGGCCGC

Variant names:

• chr2-24793181-G-GGGTGGTCGCGGTGAGTGTGCAAGGCCGC
• rs553276736
• NM_001013663.2:c.169_196dupGCGGCCTTGCACACTCACCGCGACCACC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001013663.2(PTRHD1):​c.169_196dupGCGGCCTTGCACACTCACCGCGACCACC​(p.Pro66ArgfsTer32) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 33)
• Consequence: PTRHD1 NM_001013663.2 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.54

Genes affected

PTRHD1 (HGNC:33782): (peptidyl-tRNA hydrolase domain containing 1) This gene encodes the enzyme peptidyl-tRNA hydrolase. Peptidyl-tRNA hydrolases perform the essential function of recycling peptidyl-tRNAs. Mutations in this gene are associated with autosomal-recessive intellectual disability and parkinsonism. [provided by RefSeq, May 2017]

CENPO (HGNC:28152): (centromere protein O) This gene encodes a component of the interphase centromere complex. The encoded protein is localized to the centromere throughout the cell cycle and is required for bipolar spindle assembly, chromosome segregation and checkpoint signaling during mitosis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PTRHD1	NM_001013663.2	c.169_196dupGCGGCCTTGCACACTCACCGCGACCACC	p.Pro66ArgfsTer32	frameshift_variant	Exon 1 of 2	ENST00000328379.6	NP_001013685.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PTRHD1	ENST00000328379.6	c.169_196dupGCGGCCTTGCACACTCACCGCGACCACC	p.Pro66ArgfsTer32	frameshift_variant	Exon 1 of 2	1	NM_001013663.2	ENSP00000330389.4
CENPO	ENST00000473706	c.-287_-260dupTCGCGGTGAGTGTGCAAGGCCGCGGTGG		5_prime_UTR_variant	Exon 1 of 7	2		ENSP00000417787.1
CENPO	ENST00000473476.5	n.29+23_29+50dupTCGCGGTGAGTGTGCAAGGCCGCGGTGG		intron_variant	Intron 1 of 3	4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs553276736; hg19: chr2-25016050;