2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCT

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BS1_Supporting

The NM_000939.4(POMC):c.297_298insAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGC(p.Gly99_Ala100insSerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGly) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000158 in 151,774 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.00016 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0000071 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: POMC NM_000939.4 inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.649

Genes affected

POMC (HGNC:9201): (proopiomelanocortin) This gene encodes a preproprotein that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the preproprotein and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used; adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. The antimicrobial melanotropin alpha peptide exhibits antibacterial and antifungal activity. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.000158 (24/151774) while in subpopulation AFR AF= 0.00051 (21/41146). AF 95% confidence interval is 0.000341. There are 0 homozygotes in gnomad4. There are 13 alleles in male gnomad4 subpopulation. Median coverage is 31. This position pass quality control queck. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
POMC	NM_000939.4	c.297_298insAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGC	p.Gly99_Ala100insSerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGly	inframe_insertion	3/3	ENST00000395826.7
POMC	NM_001035256.3	c.297_298insAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGC	p.Gly99_Ala100insSerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGly	inframe_insertion	4/4
POMC	NM_001319204.2	c.297_298insAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGC	p.Gly99_Ala100insSerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGly	inframe_insertion	4/4
POMC	NM_001319205.2	c.297_298insAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGC	p.Gly99_Ala100insSerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGly	inframe_insertion	3/3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
POMC	ENST00000395826.7	c.297_298insAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGCAGCAGCGGC	p.Gly99_Ala100insSerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGlySerSerGly	inframe_insertion	3/3	2	NM_000939.4	P1

Frequencies

GnomAD3 genomes AF: 0.000158 AC: 24 AN: 151774 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.000510

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000131

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.000480

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000711 AC: 10 AN: 1406034 Hom.: 0 Cov.: 33 AF XY: 0.00000432 AC XY: 3 AN XY: 694676

Gnomad4 AFR exome AF: 0.000190

Gnomad4 AMR exome AF: 0.0000543

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.0000343

GnomAD4 genome AF: 0.000158 AC: 24 AN: 151774 Hom.: 0 Cov.: 31 AF XY: 0.000175 AC XY: 13 AN XY: 74136

Gnomad4 AFR AF: 0.000510

Gnomad4 AMR AF: 0.000131

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.000480

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Apr 08, 2022

This variant, c.297_298ins81, results in the insertion of 27 amino acid(s) of the POMC protein (p.Gly99_Ala100ins27), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.08%). This variant has not been reported in the literature in individuals affected with POMC-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs10654394; hg19: chr2-25384456;