rs10654394

chr2-25161587-CGCCGCTGCT-Cchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTchr2-25161587-CGCCGCTGCT-CGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCTGCCGCTGCT

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP6

The NM_000939.4(POMC):c.289_297del(p.Ser97_Gly99del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000424 in 1,557,812 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in Lovd as Benign (no stars).

• Frequency:
  • Genomes: 𝑓 0.000046 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000042 (0 hom.)
• Consequence: POMC NM_000939.4 inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.32

Genes affected

POMC (HGNC:9201): (proopiomelanocortin) This gene encodes a preproprotein that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the preproprotein and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used; adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. The antimicrobial melanotropin alpha peptide exhibits antibacterial and antifungal activity. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 2-25161587-CGCCGCTGCT-C is Benign according to our data. Variant chr2-25161587-CGCCGCTGCT-C is described in Lovd as [Benign].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
POMC	NM_000939.4	c.289_297del	p.Ser97_Gly99del	inframe_deletion	3/3	ENST00000395826.7
POMC	NM_001035256.3	c.289_297del	p.Ser97_Gly99del	inframe_deletion	4/4
POMC	NM_001319204.2	c.289_297del	p.Ser97_Gly99del	inframe_deletion	4/4
POMC	NM_001319205.2	c.289_297del	p.Ser97_Gly99del	inframe_deletion	3/3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
POMC	ENST00000395826.7	c.289_297del	p.Ser97_Gly99del	inframe_deletion	3/3	2	NM_000939.4	P1

Frequencies

GnomAD3 genomes AF: 0.0000461 AC: 7 AN: 151776 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000729

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000588

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000390 AC: 6 AN: 153946 Hom.: 0 AF XY: 0.0000239 AC XY: 2 AN XY: 83598

Gnomad AFR exome AF: 0.000146

Gnomad AMR exome AF: 0.0000393

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000859

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000343

Gnomad OTH exome AF: 0.000228

GnomAD4 exome AF: 0.0000420 AC: 59 AN: 1406036 Hom.: 0 AF XY: 0.0000432 AC XY: 30 AN XY: 694674

Gnomad4 AFR exome AF: 0.0000949

Gnomad4 AMR exome AF: 0.0000543

Gnomad4 ASJ exome AF: 0.0000397

Gnomad4 EAS exome AF: 0.0000549

Gnomad4 SAS exome AF: 0.0000125

Gnomad4 FIN exome AF: 0.0000413

Gnomad4 NFE exome AF: 0.0000415

Gnomad4 OTH exome AF: 0.0000515

GnomAD4 genome AF: 0.0000461 AC: 7 AN: 151776 Hom.: 0 Cov.: 31 AF XY: 0.0000270 AC XY: 2 AN XY: 74138

Gnomad4 AFR AF: 0.0000729

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000588

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000120 Hom.: 42

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs10654394; hg19: chr2-25384456;