2-47369542-CTTGCCGCGGCGACGGCGACTT-C

Variant names:

• chr2-47369542-CTTGCCGCGGCGACGGCGACTT-C
• rs864622092
• NM_002354.3:c.45_65delGGCGACGGCGACTTTTGCCGC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM2 PM4

The NM_002354.3(EPCAM):​c.45_65delGGCGACGGCGACTTTTGCCGC​(p.Ala16_Ala22del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000114 in 1,584,554 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A15A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000010 (0 hom.)
• Consequence: EPCAM NM_002354.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 3.44

Genes affected

EPCAM (HGNC:11529): (epithelial cell adhesion molecule) This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_002354.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EPCAM	NM_002354.3	c.45_65delGGCGACGGCGACTTTTGCCGC	p.Ala16_Ala22del	disruptive_inframe_deletion	Exon 1 of 9	ENST00000263735.9	NP_002345.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EPCAM	ENST00000263735.9	c.45_65delGGCGACGGCGACTTTTGCCGC	p.Ala16_Ala22del	disruptive_inframe_deletion	Exon 1 of 9	1	NM_002354.3	ENSP00000263735.4

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152160 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000483

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000105 AC: 15 AN: 1432394 Hom.: 0 AF XY: 0.0000141 AC XY: 10 AN XY: 710430

Gnomad4 AFR exome AF: 0.00 AC: 0 AN: 32460

Gnomad4 AMR exome AF: 0.00 AC: 0 AN: 40186

Gnomad4 ASJ exome AF: 0.00 AC: 0 AN: 25398

Gnomad4 EAS exome AF: 0.00 AC: 0 AN: 38418

Gnomad4 SAS exome AF: 0.00 AC: 0 AN: 81824

Gnomad4 FIN exome AF: 0.0000207 AC: 1 AN: 48342

Gnomad4 NFE exome AF: 0.0000127 AC: 14 AN: 1101870

Gnomad4 Remaining exome AF: 0.00 AC: 0 AN: 59318

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152160 Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3 AN XY: 74328

Gnomad4 AFR AF: 0.0000483 AC: 0.0000482509 AN: 0.0000482509

Gnomad4 AMR AF: 0.00 AC: 0 AN: 0

Gnomad4 ASJ AF: 0.00 AC: 0 AN: 0

Gnomad4 EAS AF: 0.00 AC: 0 AN: 0

Gnomad4 SAS AF: 0.00 AC: 0 AN: 0

Gnomad4 FIN AF: 0.00 AC: 0 AN: 0

Gnomad4 NFE AF: 0.0000147 AC: 0.0000147011 AN: 0.0000147011

Gnomad4 OTH AF: 0.00 AC: 0 AN: 0

Alfa AF: 0.000142 Hom.: 0

Bravo AF: 0.0000189

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Lynch syndrome Uncertain:1

Jul 06, 2015

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change deletes 21 nucleotides from exon 1 of the EPCAM mRNA (c.38_58delTTGCCGCGGCGACGGCGACTT). This leads to the deletion of 7 amino acid residues in the EPCAM protein (p.Ala14_Phe20del) but otherwise preserves the integrity of the reading frame. This variant has not been published in the literature and is not present in population databases. This deletion is in a region that encodes the signal peptide for EPCAM protein (PMID: 23618806) and signal peptides are known to be important for membrane localization during protein synthesis. However, there is no functional evidence that deletion of this region impacts EPCAM protein synthesis and/or localization. In summary, this is a novel variant with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. -

not provided Uncertain:1

Mar 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary nonpolyposis colorectal neoplasms Uncertain:1

Sep 17, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
Mutation Taster		=146/54	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs864622092; hg19: chr2-47596681;