2-47369542-CTTGCCGCGGCGACGGCGACTT-C
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM2PM4
The NM_002354.3(EPCAM):c.45_65delGGCGACGGCGACTTTTGCCGC(p.Ala16_Ala22del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000114 in 1,584,554 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A15A) has been classified as Likely benign.
Frequency
Consequence
NM_002354.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000197 AC: 3AN: 152160Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 0.0000105 AC: 15AN: 1432394Hom.: 0 AF XY: 0.0000141 AC XY: 10AN XY: 710430 show subpopulations
GnomAD4 genome AF: 0.0000197 AC: 3AN: 152160Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3AN XY: 74328 show subpopulations
ClinVar
Submissions by phenotype
Lynch syndrome Uncertain:1
This sequence change deletes 21 nucleotides from exon 1 of the EPCAM mRNA (c.38_58delTTGCCGCGGCGACGGCGACTT). This leads to the deletion of 7 amino acid residues in the EPCAM protein (p.Ala14_Phe20del) but otherwise preserves the integrity of the reading frame. This variant has not been published in the literature and is not present in population databases. This deletion is in a region that encodes the signal peptide for EPCAM protein (PMID: 23618806) and signal peptides are known to be important for membrane localization during protein synthesis. However, there is no functional evidence that deletion of this region impacts EPCAM protein synthesis and/or localization. In summary, this is a novel variant with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. -
not provided Uncertain:1
- -
Hereditary nonpolyposis colorectal neoplasms Uncertain:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at