2-47806796-G-GTGAAAGGTCAACTGTAGATGC

Variant names:

• chr2-47806796-G-GTGAAAGGTCAACTGTAGATGC
• rs1064792973
• NM_000179.3:c.4024_4044dupAGGTCAACTGTAGATGCTGAA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000179.3(MSH6):​c.4024_4044dupAGGTCAACTGTAGATGCTGAA​(p.Arg1342_Glu1348dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000688 in 1,452,522 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: MSH6 NM_000179.3 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.863
• Publications: 1 publications found

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

FBXO11 Gene-Disease associations (from GenCC):

• intellectual developmental disorder with dysmorphic facies and behavioral abnormalities

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000179.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000179.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	NM_000179.3	MANE Select	c.4024_4044dupAGGTCAACTGTAGATGCTGAA	p.Arg1342_Glu1348dup	conservative_inframe_insertion	Exon 10 of 10	NP_000170.1
	MSH6	NM_001406795.1		c.4120_4140dupAGGTCAACTGTAGATGCTGAA	p.Arg1374_Glu1380dup	conservative_inframe_insertion	Exon 11 of 11	NP_001393724.1
	MSH6	NM_001406813.1		c.4030_4050dupAGGTCAACTGTAGATGCTGAA	p.Arg1344_Glu1350dup	conservative_inframe_insertion	Exon 10 of 10	NP_001393742.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	ENST00000234420.11	TSL:1 MANE Select	c.4024_4044dupAGGTCAACTGTAGATGCTGAA	p.Arg1342_Glu1348dup	conservative_inframe_insertion	Exon 10 of 10	ENSP00000234420.5
	MSH6	ENST00000445503.5	TSL:1	n.*3371_*3391dupAGGTCAACTGTAGATGCTGAA		non_coding_transcript_exon	Exon 9 of 9	ENSP00000405294.1
	MSH6	ENST00000445503.5	TSL:1	n.*3371_*3391dupAGGTCAACTGTAGATGCTGAA		3_prime_UTR	Exon 9 of 9	ENSP00000405294.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 6.88e-7 AC: 1 AN: 1452522 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 722538

African (AFR) AF: 0.0000301 AC: 1 AN: 33264

American (AMR) AF: 0.00 AC: 0 AN: 44382

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26038

East Asian (EAS) AF: 0.00 AC: 0 AN: 39626

South Asian (SAS) AF: 0.00 AC: 0 AN: 84680

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52672

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5738

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1105986

Other (OTH) AF: 0.00 AC: 0 AN: 60136

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:1

Oct 05, 2018

Color Diagnostics, LLC DBA Color Health

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.86

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792973; hg19: chr2-48033935;