rs1064792973

Variant names:

• chr2-47806796-GTGAAAGGTCAACTGTAGATGC-G
• rs1064792973
• NM_000179.3:c.4024_4044delAGGTCAACTGTAGATGCTGAA

Your query was ambiguous. Multiple possible variants found:

• chr2-47806796-GTGAAAGGTCAACTGTAGATGC-G
• chr2-47806796-GTGAAAGGTCAACTGTAGATGC-GTGAAAGGTCAACTGTAGATGCTGAAAGGTCAACTGTAGATGC

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP3

The NM_000179.3(MSH6):​c.4024_4044delAGGTCAACTGTAGATGCTGAA​(p.Arg1342_Glu1348del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. R1342R) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 31)
• Consequence: MSH6 NM_000179.3 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.92
• Publications: 1 publications found

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

FBXO11 Gene-Disease associations (from GenCC):

• intellectual developmental disorder with dysmorphic facies and behavioral abnormalities

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 3 benign, 47 uncertain in NM_000179.3
• PM4: Nonframeshift variant in NON repetitive region in NM_000179.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MSH6	NM_000179.3	c.4024_4044delAGGTCAACTGTAGATGCTGAA	p.Arg1342_Glu1348del	conservative_inframe_deletion	Exon 10 of 10	ENST00000234420.11	NP_000170.1
FBXO11	NM_001190274.2	c.*1301_*1321delGCATCTACAGTTGACCTTTCA		downstream_gene_variant		ENST00000403359.8	NP_001177203.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MSH6	ENST00000234420.11	c.4024_4044delAGGTCAACTGTAGATGCTGAA	p.Arg1342_Glu1348del	conservative_inframe_deletion	Exon 10 of 10	1	NM_000179.3	ENSP00000234420.5
FBXO11	ENST00000403359.8	c.*1301_*1321delGCATCTACAGTTGACCTTTCA		downstream_gene_variant		1	NM_001190274.2	ENSP00000384823.4

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary nonpolyposis colorectal neoplasms Uncertain:1

Sep 21, 2016

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, this is a novel in-frame deletion with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a MSH6-related disease. This sequence change deletes 21 nucleotides from exon 10 of the MSH6 mRNA (c.4024_4044delAGGTCAACTGTAGATGCTGAA). This leads to the deletion of 7 amino acid residue(s) in the MSH6 protein (p.Arg1342_Glu1348del) but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792973; hg19: chr2-48033935;