2-70790602-C-CGGCGCGGGGATCTAGGACGCCG

Variant names:

• chr2-70790602-C-CGGCGCGGGGATCTAGGACGCCG
• rs587776535
• NM_001004311.3:c.15_36dupCGGCGTCCTAGATCCCCGCGCC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_001004311.3(FIGLA):​c.15_36dupCGGCGTCCTAGATCCCCGCGCC​(p.Ala13ArgfsTer53) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000152 in 1,317,352 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000015 (0 hom.)
• Consequence: FIGLA NM_001004311.3 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -2.83
• Publications: 0 publications found

Genes affected

FIGLA (HGNC:24669): (folliculogenesis specific bHLH transcription factor) This gene encodes a protein that functions in postnatal oocyte-specific gene expression. The protein is a basic helix-loop-helix transcription factor that regulates multiple oocyte-specific genes, including genes involved in folliculogenesis and those that encode the zona pellucida. Mutations in this gene cause premature ovarian failure type 6. [provided by RefSeq, Sep 2009]

FIGLA Gene-Disease associations (from GenCC):

• premature ovarian failure 6

  Inheritance: AD, Unknown Classification: MODERATE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.945 CDS is truncated, and there are 3 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FIGLA	NM_001004311.3	c.15_36dupCGGCGTCCTAGATCCCCGCGCC	p.Ala13ArgfsTer53	frameshift_variant	Exon 1 of 5	ENST00000332372.6	NP_001004311.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FIGLA	ENST00000332372.6	c.15_36dupCGGCGTCCTAGATCCCCGCGCC	p.Ala13ArgfsTer53	frameshift_variant	Exon 1 of 5	1	NM_001004311.3	ENSP00000333097.6

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000152 AC: 2 AN: 1317352 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 646388

African (AFR) AF: 0.00 AC: 0 AN: 26904

American (AMR) AF: 0.00 AC: 0 AN: 28294

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 22022

East Asian (EAS) AF: 0.0000664 AC: 2 AN: 30098

South Asian (SAS) AF: 0.00 AC: 0 AN: 69248

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 32760

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4304

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1048802

Other (OTH) AF: 0.00 AC: 0 AN: 54920

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-2.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587776535; hg19: chr2-71017734;