NM_001004311.3:c.15_36dupCGGCGTCCTAGATCCCCGCGCC
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong
The NM_001004311.3(FIGLA):c.15_36dupCGGCGTCCTAGATCCCCGCGCC(p.Ala13ArgfsTer53) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000152 in 1,317,352 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001004311.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- premature ovarian failure 6Inheritance: Unknown, AD Classification: MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001004311.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FIGLA | NM_001004311.3 | MANE Select | c.15_36dupCGGCGTCCTAGATCCCCGCGCC | p.Ala13ArgfsTer53 | frameshift | Exon 1 of 5 | NP_001004311.2 | Q6QHK4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FIGLA | ENST00000332372.6 | TSL:1 MANE Select | c.15_36dupCGGCGTCCTAGATCCCCGCGCC | p.Ala13ArgfsTer53 | frameshift | Exon 1 of 5 | ENSP00000333097.6 | Q6QHK4 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000152 AC: 2AN: 1317352Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 646388 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at