2-70790602-CGGCGCGGGGATCTAGGACGCCG-CGGCGCGGGGATCTAGGACGCCGGGCGCGGGGATCTAGGACGCCG

Variant names:

• chr2-70790602-C-CGGCGCGGGGATCTAGGACGCCG
• NM_001004311.3:c.15_36dupCGGCGTCCTAGATCCCCGCGCC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001004311.3(FIGLA):​c.15_36dupCGGCGTCCTAGATCCCCGCGCC​(p.Ala13ArgfsTer53) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000152 in 1,317,352 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000015 (0 hom.)
• Consequence: FIGLA NM_001004311.3 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -2.83

Genes affected

FIGLA (HGNC:24669): (folliculogenesis specific bHLH transcription factor) This gene encodes a protein that functions in postnatal oocyte-specific gene expression. The protein is a basic helix-loop-helix transcription factor that regulates multiple oocyte-specific genes, including genes involved in folliculogenesis and those that encode the zona pellucida. Mutations in this gene cause premature ovarian failure type 6. [provided by RefSeq, Sep 2009]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FIGLA	NM_001004311.3	c.15_36dupCGGCGTCCTAGATCCCCGCGCC	p.Ala13ArgfsTer53	frameshift_variant	Exon 1 of 5	ENST00000332372.6	NP_001004311.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FIGLA	ENST00000332372.6	c.15_36dupCGGCGTCCTAGATCCCCGCGCC	p.Ala13ArgfsTer53	frameshift_variant	Exon 1 of 5	1	NM_001004311.3	ENSP00000333097.6

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000152 AC: 2 AN: 1317352 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 646388

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000664

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-71017734;