2-9490180-GCACTCTGTTTCTTTGCTGTCAA-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_ModeratePM2

The NM_003183.6(ADAM17):​c.2450_2471delTTGACAGCAAAGAAACAGAGTG​(p.Val817AlafsTer30) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

ADAM17
NM_003183.6 frameshift

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.60
Variant links:
Genes affected
ADAM17 (HGNC:195): (ADAM metallopeptidase domain 17) This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands, and plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease. Additionally, this protease may play a role in viral infection through its cleavage of ACE2, the cellular receptor for SARS-CoV and SARS-CoV-2. [provided by RefSeq, Aug 2020]
IAH1 (HGNC:27696): (isoamyl acetate hydrolyzing esterase 1 (putative)) Enables identical protein binding activity. Predicted to be involved in lipid catabolic process. [provided by Alliance of Genome Resources, Apr 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0101 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ADAM17NM_003183.6 linkc.2450_2471delTTGACAGCAAAGAAACAGAGTG p.Val817AlafsTer30 frameshift_variant Exon 19 of 19 ENST00000310823.8 NP_003174.3 P78536-1B2RNB2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ADAM17ENST00000310823.8 linkc.2450_2471delTTGACAGCAAAGAAACAGAGTG p.Val817AlafsTer30 frameshift_variant Exon 19 of 19 1 NM_003183.6 ENSP00000309968.3 P78536-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Inborn genetic diseases Uncertain:1
May 10, 2018
Ambry Genetics
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1662003677; hg19: chr2-9630309; API