2-9490180-GCACTCTGTTTCTTTGCTGTCAA-G

Position:

• chr2-9490180-GCACTCTGTTTCTTTGCTGTCAA-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_003183.6(ADAM17):​c.2450_2471delTTGACAGCAAAGAAACAGAGTG​(p.Val817fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ADAM17 NM_003183.6 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.60

Genes affected

ADAM17 (HGNC:195): (ADAM metallopeptidase domain 17) This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands, and plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease. Additionally, this protease may play a role in viral infection through its cleavage of ACE2, the cellular receptor for SARS-CoV and SARS-CoV-2. [provided by RefSeq, Aug 2020]

IAH1 (HGNC:27696): (isoamyl acetate hydrolyzing esterase 1 (putative)) Enables identical protein binding activity. Predicted to be involved in lipid catabolic process. [provided by Alliance of Genome Resources, Apr 2022]

ADAM17 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0101 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ADAM17	NM_003183.6	c.2450_2471delTTGACAGCAAAGAAACAGAGTG	p.Val817fs	frameshift_variant	19/19	ENST00000310823.8	NP_003174.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ADAM17	ENST00000310823.8	c.2450_2471delTTGACAGCAAAGAAACAGAGTG	p.Val817fs	frameshift_variant	19/19	1	NM_003183.6	ENSP00000309968.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

May 10, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1662003677; hg19: chr2-9630309;