2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T

Position:

• chr2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_020184.4(CNNM4):​c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC​(p.Val4ProfsTer214) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000001 in 997,316 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000010 (0 hom.)
• Consequence: CNNM4 NM_020184.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 2.98

Genes affected

CNNM4 (HGNC:105): (cyclin and CBS domain divalent metal cation transport mediator 4) This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play a role in metal ion transport. Mutations in this gene are associated with Jalili syndrome which consists of cone-rod dystrophy and amelogenesis imperfecta. [provided by RefSeq, Feb 2010]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 25 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T is Pathogenic according to our data. Variant chr2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T is described in ClinVar as [Pathogenic]. Clinvar id is 3249983.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CNNM4	NM_020184.4	c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC	p.Val4ProfsTer214	frameshift_variant	Exon 1 of 7	ENST00000377075.3	NP_064569.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CNNM4	ENST00000377075.3	c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC	p.Val4ProfsTer214	frameshift_variant	Exon 1 of 7	1	NM_020184.4	ENSP00000366275.2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 0.00000100 AC: 1 AN: 997316 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 469172

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000115

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Retinal dystrophy Pathogenic:1

Pathogenic, no assertion criteria provided

clinical testing

Institute of Human Genetics, Univ. Regensburg, Univ. Regensburg

Jan 01, 2016

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-97426738;