2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_020184.4(CNNM4):c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC(p.Val4ProfsTer214) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000001 in 997,316 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. P3P) has been classified as Likely benign.
Frequency
Consequence
NM_020184.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- Jalili syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_020184.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CNNM4 | TSL:1 MANE Select | c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC | p.Val4ProfsTer214 | frameshift | Exon 1 of 7 | ENSP00000366275.2 | Q6P4Q7-1 | ||
| CNNM4 | c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC | p.Val4ProfsTer214 | frameshift | Exon 1 of 7 | ENSP00000600341.1 | ||||
| CNNM4 | c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC | p.Val4ProfsTer214 | frameshift | Exon 1 of 8 | ENSP00000636824.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome AF: 0.00000100 AC: 1AN: 997316Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 469172 show subpopulations
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at