chr2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T

Variant names:

• chr2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T
• NM_020184.4:c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_020184.4(CNNM4):​c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC​(p.Val4ProfsTer214) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000001 in 997,316 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. P3P) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000010 (0 hom.)
• Consequence: CNNM4 NM_020184.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 2.98

Genes affected

CNNM4 (HGNC:105): (cyclin and CBS domain divalent metal cation transport mediator 4) This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play a role in metal ion transport. Mutations in this gene are associated with Jalili syndrome which consists of cone-rod dystrophy and amelogenesis imperfecta. [provided by RefSeq, Feb 2010]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 53 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T is Pathogenic according to our data. Variant chr2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T is described in ClinVar as [Pathogenic]. Clinvar id is 3249983.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CNNM4	NM_020184.4	c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC	p.Val4ProfsTer214	frameshift_variant	Exon 1 of 7	ENST00000377075.3	NP_064569.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CNNM4	ENST00000377075.3	c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC	p.Val4ProfsTer214	frameshift_variant	Exon 1 of 7	1	NM_020184.4	ENSP00000366275.2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 0.00000100 AC: 1 AN: 997316 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 469172

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000115

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Retinal dystrophy Pathogenic:1

Jan 01, 2016

Institute of Human Genetics, Univ. Regensburg, Univ. Regensburg

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-97426738;