chr2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T

Variant names:

• chr2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T
• NM_020184.4:c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_020184.4(CNNM4):​c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC​(p.Val4ProfsTer214) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000001 in 997,316 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. P3P) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000010 (0 hom.)
• Consequence: CNNM4 NM_020184.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 2.98
• Publications: 0 publications found

Genes affected

CNNM4 (HGNC:105): (cyclin and CBS domain divalent metal cation transport mediator 4) This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play a role in metal ion transport. Mutations in this gene are associated with Jalili syndrome which consists of cone-rod dystrophy and amelogenesis imperfecta. [provided by RefSeq, Feb 2010]

CNNM4 Gene-Disease associations (from GenCC):

• Jalili syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 44 pathogenic variants in the truncated region.
• PP5: Variant 2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T is Pathogenic according to our data. Variant chr2-96761001-TGGCGCCGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 3249983.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020184.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CNNM4	NM_020184.4	MANE Select	c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC	p.Val4ProfsTer214	frameshift	Exon 1 of 7	NP_064569.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CNNM4	ENST00000377075.3	TSL:1 MANE Select	c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC	p.Val4ProfsTer214	frameshift	Exon 1 of 7	ENSP00000366275.2	Q6P4Q7-1
	CNNM4	ENST00000930282.1		c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC	p.Val4ProfsTer214	frameshift	Exon 1 of 7	ENSP00000600341.1
	CNNM4	ENST00000966765.1		c.9_55delGGTGGGCGGGGGCGGGCGCCCGGTCGGCGGACCGGCCCGCGGGCGCC	p.Val4ProfsTer214	frameshift	Exon 1 of 8	ENSP00000636824.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 0.00000100 AC: 1 AN: 997316 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 469172

African (AFR) AF: 0.00 AC: 0 AN: 19958

American (AMR) AF: 0.00 AC: 0 AN: 5712

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 10730

East Asian (EAS) AF: 0.00 AC: 0 AN: 18310

South Asian (SAS) AF: 0.00 AC: 0 AN: 18788

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 17186

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2472

European-Non Finnish (NFE) AF: 0.00000115 AC: 1 AN: 866528

Other (OTH) AF: 0.00 AC: 0 AN: 37632

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Retinal dystrophy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr2-97426738;