20-2652732-AGGGCCTGGGCCT-AGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_006392.4(NOP56):c.3+71_4-85dupGGCCTGGGCCTGGGCCTGGGCCTG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000727 in 962,360 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_006392.4 intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| NOP56 | NM_006392.4 | c.3+71_4-85dupGGCCTGGGCCTGGGCCTGGGCCTG | intron_variant | Intron 1 of 11 | ENST00000329276.10 | NP_006383.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| NOP56 | ENST00000329276.10 | c.3+71_4-85dupGGCCTGGGCCTGGGCCTGGGCCTG | intron_variant | Intron 1 of 11 | 1 | NM_006392.4 | ENSP00000370589.3 |
Frequencies
GnomAD3 genomes Cov.: 0
GnomAD4 exome AF: 0.00000727 AC: 7AN: 962360Hom.: 0 Cov.: 33 AF XY: 0.0000104 AC XY: 5AN XY: 480058 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 0
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at