rs1555779353

chr20-2652732-AGGGCCTGGGCCT-Achr20-2652732-AGGGCCTGGGCCT-AGGGCCTchr20-2652732-AGGGCCTGGGCCT-AGGGCCTGGGCCTGGGCCTchr20-2652732-AGGGCCTGGGCCT-AGGGCCTGGGCCTGGGCCTGGGCCTchr20-2652732-AGGGCCTGGGCCT-AGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTchr20-2652732-AGGGCCTGGGCCT-AGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTchr20-2652732-AGGGCCTGGGCCT-AGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCT

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_006392.4(NOP56):c.3+83_4-85del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000298 in 1,108,360 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000034 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000029 (0 hom.)
• Consequence: NOP56 NM_006392.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.12

Genes affected

NOP56 (HGNC:15911): (NOP56 ribonucleoprotein) Nop56p is a yeast nucleolar protein that is part of a complex with the nucleolar proteins Nop58p and fibrillarin. Nop56p is required for assembly of the 60S ribosomal subunit and is involved in pre-rRNA processing. The protein encoded by this gene is similar in sequence to Nop56p and is also found in the nucleolus. Expansion of a GGCCTG repeat from 3-8 copies to 1500-2500 copies in an intron of this gene results in spinocerebellar ataxia 36. Multiple transcript variants encoding several different isoforms have been found for this gene, but the full-length nature of most of them has not been determined. [provided by RefSeq, Jul 2016]

MIR1292 (HGNC:35364): (microRNA 1292) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd at 5 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
NOP56	NM_006392.4	c.3+83_4-85del		intron_variant		ENST00000329276.10
NOP56	NR_027700.3	n.32+83_33-85del		intron_variant, non_coding_transcript_variant
NOP56	NR_145428.2	n.32+83_33-85del		intron_variant, non_coding_transcript_variant
MIR1292	NR_031699.1			upstream_gene_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
NOP56	ENST00000329276.10	c.3+83_4-85del		intron_variant		1	NM_006392.4	P1
MIR1292	ENST00000408135.1			upstream_gene_variant

Frequencies

GnomAD3 genomes AF: 0.0000343 AC: 5 AN: 145896 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000623

Gnomad SAS AF: 0.000216

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000153

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000291 AC: 28 AN: 962360 Hom.: 0 AF XY: 0.0000292 AC XY: 14 AN XY: 480058

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000630

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000812

Gnomad4 OTH exome AF: 0.000120

GnomAD4 genome AF: 0.0000342 AC: 5 AN: 146000 Hom.: 0 Cov.: 0 AF XY: 0.0000281 AC XY: 2 AN XY: 71146

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000625

Gnomad4 SAS AF: 0.000216

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000153

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000491

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555779353; hg19: chr20-2633378;