20-34560900-T-TTGGCGGTCAAGTAGAGGCCATGTG

Variant names:

• chr20-34560900-T-TTGGCGGTCAAGTAGAGGCCATGTG
• NM_080476.5:c.1250_1273dupCACATGGCCTCTACTTGACCGCCA

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_080476.5(PIGU):​c.1250_1273dupCACATGGCCTCTACTTGACCGCCA​(p.Thr417_Ala424dup) variant causes a conservative inframe insertion change. The variant allele was found at a frequency of 0.00000205 in 1,460,190 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 34)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: PIGU NM_080476.5 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.33

Genes affected

PIGU (HGNC:15791): (phosphatidylinositol glycan anchor biosynthesis class U) The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Cdc91, a predicted integral membrane protein that may function in cell division control. The protein encoded by this gene is the fifth subunit of GPI transamidase that attaches GPI-anchors to proteins. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_080476.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PIGU	NM_080476.5	c.1250_1273dupCACATGGCCTCTACTTGACCGCCA	p.Thr417_Ala424dup	conservative_inframe_insertion	Exon 12 of 12	ENST00000217446.8	NP_536724.1
PIGU	XM_017027664.2	c.1106_1129dupCACATGGCCTCTACTTGACCGCCA	p.Thr369_Ala376dup	conservative_inframe_insertion	Exon 11 of 11		XP_016883153.1
PIGU	XM_011528542.2	c.602_625dupCACATGGCCTCTACTTGACCGCCA	p.Thr201_Ala208dup	conservative_inframe_insertion	Exon 6 of 6		XP_011526844.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PIGU	ENST00000217446.8	c.1250_1273dupCACATGGCCTCTACTTGACCGCCA	p.Thr417_Ala424dup	conservative_inframe_insertion	Exon 12 of 12	1	NM_080476.5	ENSP00000217446.3
PIGU	ENST00000374820.6	c.1190_1213dupCACATGGCCTCTACTTGACCGCCA	p.Thr397_Ala404dup	conservative_inframe_insertion	Exon 11 of 11	1		ENSP00000363953.2
PIGU	ENST00000438215.1	c.488_*2dupCACATGGCCTCTACTTGACCGCCA		downstream_gene_variant		3		ENSP00000395755.1

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1460190 Hom.: 0 Cov.: 30 AF XY: 0.00000275 AC XY: 2 AN XY: 726454

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000757

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 34

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Feb 21, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant, c.1250_1273dup, results in the insertion of 8 amino acid(s) of the PIGU protein (p.Thr417_Ala424dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with PIGU-related conditions. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr20-33148704;