rs1064792904

Variant names:

• chr20-37179358-T-TGGCGCCGCCGGGTGAGGAGTTGCGCGTGG
• rs1064792904
• NM_152503.8:c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_152503.8(MROH8):​c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC​(p.His41ProfsTer51) variant causes a frameshift change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 0)
• Consequence: MROH8 NM_152503.8 frameshift
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 4.13
• Publications: 0 publications found

Genes affected

MROH8 (HGNC:16125): (maestro heat like repeat family member 8) The protein encoded by this gene belongs to the maestro heat-like repeat family. The exact function of this gene is not known, however, in a genome-wide association study using hippocampal atrophy as a quantitative trait, this gene has been associated with Alzheimer's disease (PMID:19668339). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

RPN2 (HGNC:10382): (ribophorin II) This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 20-37179358-T-TGGCGCCGCCGGGTGAGGAGTTGCGCGTGG is Benign according to our data. Variant chr20-37179358-T-TGGCGCCGCCGGGTGAGGAGTTGCGCGTGG is described in ClinVar as Benign. ClinVar VariationId is 403105.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_152503.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MROH8	NM_152503.8	MANE Select	c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC	p.His41ProfsTer51	frameshift	Exon 2 of 25	NP_689716.4
	RPN2	NM_002951.5	MANE Select	c.3_13+18dupGGCGCCGCCGGGTGAGGAGTTGCGCGTGG		intron	N/A	NP_002942.2
	MROH8	NM_213631.3		c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC	p.His41ProfsTer51	frameshift	Exon 2 of 14	NP_998796.1	A0AAG2UW82

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MROH8	ENST00000343811.10	TSL:1	c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC	p.His41ProfsTer51	frameshift	Exon 2 of 25	ENSP00000513568.1	A0A8V8TLY2
	MROH8	ENST00000400440.7	TSL:1	c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC	p.His41ProfsTer51	frameshift	Exon 2 of 14	ENSP00000513569.1	A0A8V8TN72
	MROH8	ENST00000422138.2	TSL:3	c.93_121dupCCACGCGCAACTCCTCACCCGGCGGCGCC	p.His41ProfsTer51	frameshift	Exon 2 of 23	ENSP00000400468.2	Q5JYQ9

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Cov.: 13

GnomAD4 genome Cov.: 0

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792904; hg19: chr20-35807761;