20-3889136-TTGGGCGGCGCCGCCATCACTCTCTTC-T
Variant summary
Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PVS1PP5
The NM_153638.4(PANK2):c.42_67delGGCGCCGCCATCACTCTCTTCTGGGC(p.Ala15ThrfsTer24) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000048 in 1,563,938 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_153638.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 9 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PANK2 | NM_001386393.1 | c.-294_-269delTGGGCGGCGCCGCCATCACTCTCTTC | upstream_gene_variant | ENST00000610179.7 | NP_001373322.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000197 AC: 3AN: 152084Hom.: 0 Cov.: 33
GnomAD3 exomes AF: 0.0000230 AC: 4AN: 173688Hom.: 0 AF XY: 0.0000215 AC XY: 2AN XY: 92972
GnomAD4 exome AF: 0.0000482 AC: 68AN: 1411740Hom.: 0 AF XY: 0.0000358 AC XY: 25AN XY: 697604
GnomAD4 genome AF: 0.0000460 AC: 7AN: 152198Hom.: 1 Cov.: 33 AF XY: 0.0000537 AC XY: 4AN XY: 74430
ClinVar
Submissions by phenotype
Pigmentary pallidal degeneration Pathogenic:1Uncertain:1
This sequence change creates a premature translational stop signal (p.Ala15Thrfs*24) in the PANK2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 556 amino acid(s) of the PANK2 protein. This variant is present in population databases (rs760822872, gnomAD 0.006%). This variant has not been reported in the literature in individuals affected with PANK2-related conditions. ClinVar contains an entry for this variant (Variation ID: 422512). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Variant summary: PANK2 c.42_67del26 (p.Ala15ThrfsX24) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant allele was found at a frequency of 2.3e-05 in 173688 control chromosomes (gnomAD). To our knowledge, no occurrence of c.42_67del26 in individuals affected with Pantothenate Kinase-Associated Neurodegeneration and no experimental evidence demonstrating its impact on protein function have been reported. One ClinVar submitter (evaluation after 2014) cites the variant as likely pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic. -
not provided Pathogenic:1
The c.42_67del26 variant in the PANK2 gene has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. The c.42_67del26 variant causes a frameshift starting with codon Alanine 15, changes this amino acid to a Threonine residue, and creates a premature Stop codon at position 24 of the new reading frame, denoted p.Ala15ThrfsX24. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. The c.42_67del26 variant was not observed in approximately 6500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, indicating it is not a common benign variant in these populations. We interpret c.42_67del26 as a strong candidate for a pathogenic variant, however the possibility it may be a rare benign variant cannot be excluded. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at