ENST00000316562.9:c.42_67delGGCGCCGCCATCACTCTCTTCTGGGC

Variant names:

• chr20-3889136-TTGGGCGGCGCCGCCATCACTCTCTTC-T
• rs760822872
• ENST00000316562.9:c.42_67delGGCGCCGCCATCACTCTCTTCTGGGC

Variant summary

Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PVS1 PP5

The ENST00000316562.9(PANK2):​c.42_67delGGCGCCGCCATCACTCTCTTCTGGGC​(p.Ala15ThrfsTer24) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000048 in 1,563,938 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. A14A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000046 (1 hom., cov: 33)
  • Exomes 𝑓: 0.000048 (0 hom.)
• Consequence: PANK2 ENST00000316562.9 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:2 U:1
• Conservation: PhyloP100: 2.32

Genes affected

PANK2 (HGNC:15894): (pantothenate kinase 2) This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]

PANK2-AS1 (HGNC:40732): (PANK2 antisense RNA 1)

ACMG classification

Verdict is Likely_pathogenic. Variant got 9 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 135 pathogenic variants in the truncated region.
• PP5: Variant 20-3889136-TTGGGCGGCGCCGCCATCACTCTCTTC-T is Pathogenic according to our data. Variant chr20-3889136-TTGGGCGGCGCCGCCATCACTCTCTTC-T is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 422512.We mark this variant Likely_pathogenic, oryginal submissions are: {Likely_pathogenic=2, Uncertain_significance=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PANK2	NM_001386393.1	c.-294_-269delTGGGCGGCGCCGCCATCACTCTCTTC		upstream_gene_variant		ENST00000610179.7	NP_001373322.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PANK2	ENST00000610179.7	c.-294_-269delTGGGCGGCGCCGCCATCACTCTCTTC		upstream_gene_variant		1	NM_001386393.1	ENSP00000477429.2

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152084 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000230 AC: 4 AN: 173688 Hom.: 0 AF XY: 0.0000215 AC XY: 2 AN XY: 92972

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000568

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000482 AC: 68 AN: 1411740 Hom.: 0 AF XY: 0.0000358 AC XY: 25 AN XY: 697604

Gnomad4 AFR exome AF: 0.0000311

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000608

Gnomad4 OTH exome AF: 0.0000171

GnomAD4 genome AF: 0.0000460 AC: 7 AN: 152198 Hom.: 1 Cov.: 33 AF XY: 0.0000537 AC XY: 4 AN XY: 74430

Gnomad4 AFR AF: 0.0000241

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000294

Gnomad4 OTH AF: 0.00190

Alfa AF: 0.0000843 Hom.: 0

Bravo AF: 0.0000302

Asia WGS AF: 0.00404 AC: 14 AN: 3478

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:2 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Pigmentary pallidal degeneration Pathogenic:1 Uncertain:1

Aug 23, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Ala15Thrfs*24) in the PANK2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 556 amino acid(s) of the PANK2 protein. This variant is present in population databases (rs760822872, gnomAD 0.006%). This variant has not been reported in the literature in individuals affected with PANK2-related conditions. ClinVar contains an entry for this variant (Variation ID: 422512). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Sep 02, 2021

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: PANK2 c.42_67del26 (p.Ala15ThrfsX24) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant allele was found at a frequency of 2.3e-05 in 173688 control chromosomes (gnomAD). To our knowledge, no occurrence of c.42_67del26 in individuals affected with Pantothenate Kinase-Associated Neurodegeneration and no experimental evidence demonstrating its impact on protein function have been reported. One ClinVar submitter (evaluation after 2014) cites the variant as likely pathogenic. Based on the evidence outlined above, the variant was classified as likely pathogenic. -

not provided Pathogenic:1

Oct 27, 2016

GeneDx

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.42_67del26 variant in the PANK2 gene has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. The c.42_67del26 variant causes a frameshift starting with codon Alanine 15, changes this amino acid to a Threonine residue, and creates a premature Stop codon at position 24 of the new reading frame, denoted p.Ala15ThrfsX24. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. The c.42_67del26 variant was not observed in approximately 6500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, indicating it is not a common benign variant in these populations. We interpret c.42_67del26 as a strong candidate for a pathogenic variant, however the possibility it may be a rare benign variant cannot be excluded. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs760822872; hg19: chr20-3869783;