21-44285977-GCCCCAGCCCCGGGTCCCCGCGCCCA-G

Position:

• chr21-44285977-GCCCCAGCCCCGGGTCCCCGCGCCCA-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PM2

The NM_000383.4(AIRE):​c.-24_1delGCCCCGGGTCCCCGCGCCCACCCCA​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000292 in 1,368,746 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000029 (0 hom.)
• Consequence: AIRE NM_000383.4 frameshift, start_lost
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.431

Genes affected

AIRE (HGNC:360): (autoimmune regulator) This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]

AIRE (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 65 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_000383.4 (AIRE) was described as [Pathogenic] in Lovd
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AIRE	NM_000383.4	c.-24_1delGCCCCGGGTCCCCGCGCCCACCCCA	p.Met1fs	frameshift_variant, start_lost	1/14	ENST00000291582.6	NP_000374.1
AIRE	NM_000383.4	c.-24_1delGCCCCGGGTCCCCGCGCCCACCCCA		5_prime_UTR_variant	1/14	ENST00000291582.6	NP_000374.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AIRE	ENST00000291582.6	c.-24_1delGCCCCGGGTCCCCGCGCCCACCCCA	p.Met1fs	frameshift_variant, start_lost	1/14	1	NM_000383.4	ENSP00000291582.5
AIRE	ENST00000291582	c.-24_1delGCCCCGGGTCCCCGCGCCCACCCCA		5_prime_UTR_variant	1/14	1	NM_000383.4	ENSP00000291582.5
AIRE	ENST00000527919.5	n.138_162delGCCCCGGGTCCCCGCGCCCACCCCA		non_coding_transcript_exon_variant	1/14	2
AIRE	ENST00000530812.5	n.146_170delGCCCCGGGTCCCCGCGCCCACCCCA		non_coding_transcript_exon_variant	1/12	2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000292 AC: 4 AN: 1368746 Hom.: 0 AF XY: 0.00000296 AC XY: 2 AN XY: 675318

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000373

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Polyglandular autoimmune syndrome, type 1 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Counsyl

Feb 16, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555871766; hg19: chr21-45705860;