AIRE
autoimmune regulator, the group of PHD finger proteins
Basic information
Region (hg38): 21:44285838-44298648
Previous symbols: [ "APECED" ]
Links
Phenotypes
GenCC
Source:
- autoimmune polyendocrine syndrome type 1 (Definitive), mode of inheritance: AR
- autoimmune polyendocrine syndrome type 1 (Strong), mode of inheritance: AR
- autoimmune polyendocrine syndrome type 1 (Strong), mode of inheritance: AD
- autoimmune polyendocrine syndrome type 1 (Strong), mode of inheritance: AR
- autoimmune polyendocrine syndrome type 1 (Supportive), mode of inheritance: AR
- familial isolated hypoparathyroidism due to impaired PTH secretion (Supportive), mode of inheritance: AD
- autoimmune polyendocrine syndrome type 1 (Moderate), mode of inheritance: AD
- autoimmune polyendocrine syndrome type 1 (Definitive), mode of inheritance: AR
- autoimmune polyendocrine syndrome type 1 (Strong), mode of inheritance: AR
- autoimmune polyendocrine syndrome type 1 (Strong), mode of inheritance: AD
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Autoimmune polyendocrinopathy syndrome, type I, with or without reversible metaphyseal dysplasia | AD/AR | Allergy/Immunology/Infectious; Endocrine | Individuals need life-long follow-up, as sequelae may appear later in life; Endocrine findings can include adrenocortical failure and severe hypocalcemia; Infectious complications, such as candiasis, and septicemia, are frequent, and prompt and aggressive treatment of infections may be beneficial | Allergy/Immunology/Infectious; Dermatologic; Endocrine; Gastrointestinal; Hematologic; Ophthalmologic | 7024719; 3496374; 2348835; 1453436; 9398840; 9398839; 9543115; 9837820; 9717837; 11018166; 11600535; 14557425; 16965330; 17539912; 19758376; 19807739; 25926518 |
ClinVar
This is a list of variants' phenotypes submitted to
- Polyglandular autoimmune syndrome, type 1 (88 variants)
- not provided (15 variants)
- AIRE-related disorder (1 variants)
- Autoimmune polyglandular syndrome type 1, with reversible metaphyseal dysplasia (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the AIRE gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 313 | 321 | ||||
| missense | 22 | 281 | 15 | 327 | ||
| nonsense | 25 | 13 | 39 | |||
| start loss | 7 | |||||
| frameshift | 44 | 32 | 77 | |||
| inframe indel | 10 | |||||
| splice donor/acceptor (+/-2bp) | 26 | 33 | ||||
| splice region | 1 | 1 | 20 | 65 | 2 | 89 |
| non coding | 151 | 46 | 204 | |||
| Total | 88 | 94 | 302 | 479 | 55 |
Highest pathogenic variant AF is 0.000565
Variants in AIRE
This is a list of pathogenic ClinVar variants found in the AIRE region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 21-44285930-C-A | Benign (May 10, 2021) | |||
| 21-44285966-C-A | Benign (Mar 03, 2015) | |||
| 21-44285977-GCCCCAGCCCCGGGTCCCCGCGCCCA-G | Polyglandular autoimmune syndrome, type 1 | Uncertain significance (Feb 16, 2018) | ||
| 21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C | Polyglandular autoimmune syndrome, type 1 | Pathogenic (Sep 22, 2019) | ||
| 21-44286003-C-A | Polyglandular autoimmune syndrome, type 1 | Uncertain significance (Apr 20, 2020) | ||
| 21-44286007-A-G | Polyglandular autoimmune syndrome, type 1 • Inherited Immunodeficiency Diseases | Pathogenic/Likely pathogenic (May 21, 2021) | ||
| 21-44286007-A-T | Polyglandular autoimmune syndrome, type 1 | Pathogenic (Aug 16, 2023) | ||
| 21-44286008-T-A | Polyglandular autoimmune syndrome, type 1 | Pathogenic (Jul 26, 2021) | ||
| 21-44286008-T-C | Polyglandular autoimmune syndrome, type 1 | Pathogenic (Aug 05, 2022) | ||
| 21-44286008-T-G | Polyglandular autoimmune syndrome, type 1 | Pathogenic (Jan 11, 2022) | ||
| 21-44286013-A-C | Inborn genetic diseases | Uncertain significance (Jul 13, 2021) | ||
| 21-44286015-G-A | Polyglandular autoimmune syndrome, type 1 | Likely benign (Jun 03, 2023) | ||
| 21-44286015-G-C | Polyglandular autoimmune syndrome, type 1 | Likely benign (Sep 07, 2022) | ||
| 21-44286016-G-A | Polyglandular autoimmune syndrome, type 1 | Uncertain significance (Jan 07, 2024) | ||
| 21-44286017-A-C | Inborn genetic diseases | Uncertain significance (Sep 16, 2021) | ||
| 21-44286017-A-T | Polyglandular autoimmune syndrome, type 1 | Uncertain significance (Aug 05, 2021) | ||
| 21-44286017-ACG-A | Polyglandular autoimmune syndrome, type 1 | Pathogenic (Nov 13, 2021) | ||
| 21-44286018-C-T | Polyglandular autoimmune syndrome, type 1 | Likely benign (Oct 03, 2023) | ||
| 21-44286019-G-A | Polyglandular autoimmune syndrome, type 1 | Uncertain significance (Jul 19, 2022) | ||
| 21-44286019-GC-TT | Polyglandular autoimmune syndrome, type 1 | Uncertain significance (Apr 16, 2021) | ||
| 21-44286021-G-T | Polyglandular autoimmune syndrome, type 1 | Likely benign (Jul 03, 2023) | ||
| 21-44286022-GCGCTA-G | Polyglandular autoimmune syndrome, type 1 | Likely pathogenic (Jan 15, 2018) | ||
| 21-44286024-G-C | Polyglandular autoimmune syndrome, type 1 | Likely benign (Nov 23, 2020) | ||
| 21-44286024-GCTACGCCGGCTTCTGAGGCTGCACCGCACGGAGATCGCGGTGGCCGTGGACAGCGCCTTCCCACTGCTGCACGCGCTGGCTGACCACGACGTGGTC-G | Polyglandular autoimmune syndrome, type 1 | Pathogenic (Sep 14, 2023) | ||
| 21-44286027-A-C | Polyglandular autoimmune syndrome, type 1 | Likely benign (Jan 20, 2023) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| AIRE | protein_coding | protein_coding | ENST00000291582 | 14 | 12811 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 4.05e-12 | 0.313 | 125194 | 1 | 408 | 125603 | 0.00163 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | -0.00206 | 351 | 351 | 1.00 | 0.0000226 | 3420 |
| Missense in Polyphen | 89 | 118.55 | 0.75071 | 1221 | ||
| Synonymous | -0.131 | 162 | 160 | 1.01 | 0.0000116 | 1184 |
| Loss of Function | 1.09 | 21 | 27.1 | 0.775 | 0.00000147 | 289 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.00147 | 0.00144 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.00153 | 0.00152 |
| Finnish | 0.00522 | 0.00514 |
| European (Non-Finnish) | 0.00193 | 0.00189 |
| Middle Eastern | 0.00153 | 0.00152 |
| South Asian | 0.000229 | 0.000229 |
| Other | 0.00199 | 0.00196 |
dbNSFP
Source:
- Function
- FUNCTION: Transcription factor playing an essential role to promote self-tolerance in the thymus by regulating the expression of a wide array of self-antigens that have the commonality of being tissue-restricted in their expression pattern in the periphery, called tissue restricted antigens (TRA) (PubMed:26084028). Binds to G-doublets in an A/T-rich environment; the preferred motif is a tandem repeat of 5'-ATTGGTTA-3' combined with a 5'-TTATTA-3' box. Binds to nucleosomes (By similarity). Binds to chromatin and interacts selectively with histone H3 that is not methylated at 'Lys-4', not phosphorylated at 'Thr-3' and not methylated at 'Arg-2'. Functions as a sensor of histone H3 modifications that are important for the epigenetic regulation of gene expression. Mainly expressed by medullary thymic epithelial cells (mTECs), induces the expression of thousands of tissue- restricted proteins, which are presented on major histocompatibility complex class I (MHC-I) and MHC-II molecules to developing T-cells percolating through the thymic medulla (PubMed:26084028). Also induces self-tolerance through other mechanisms such as the regulation of the mTEC differentiation program. Controls the medullary accumulation of thymic dendritic cells and the development of regulatory T-cell through the regulation of XCL1 expression. Regulates the production of CCR4 and CCR7 ligands in medullary thymic epithelial cells and alters the coordinated maturation and migration of thymocytes. In thimic B-cells, allows the presentation of licensing-dependent endogenous self-anitgen for negative selection. In secondary lymphoid organs, induces functional inactivation of CD4(+) T-cells. Expressed by a distinct bone marrow-derived population, induces self-tolerance through a mechanism that does not require regulatory T-cells and is resitant to innate inflammatory stimuli (By similarity). {ECO:0000250|UniProtKB:Q9Z0E3, ECO:0000269|PubMed:11274163, ECO:0000269|PubMed:18292755, ECO:0000269|PubMed:26084028, ECO:0000305|PubMed:19302042, ECO:0000305|PubMed:26972725}.;
- Disease
- DISEASE: Autoimmune polyendocrine syndrome 1, with or without reversible metaphyseal dysplasia (APS1) [MIM:240300]: A rare disease characterized by the combination of chronic mucocutaneous candidiasis, hypoparathyroidism and Addison disease. Symptoms of mucocutaneous candidiasis manifest first, followed by hypotension or fatigue occurring as a result of Addison disease. APS1 is associated with other autoimmune disorders including diabetes mellitus, vitiligo, alopecia, hepatitis, pernicious anemia and primary hypothyroidism. {ECO:0000269|PubMed:10677297, ECO:0000269|PubMed:11274163, ECO:0000269|PubMed:11275943, ECO:0000269|PubMed:11524731, ECO:0000269|PubMed:11524733, ECO:0000269|PubMed:11600535, ECO:0000269|PubMed:11836330, ECO:0000269|PubMed:12050215, ECO:0000269|PubMed:12173302, ECO:0000269|PubMed:12625412, ECO:0000269|PubMed:14974083, ECO:0000269|PubMed:15649886, ECO:0000269|PubMed:15712268, ECO:0000269|PubMed:16114041, ECO:0000269|PubMed:18292755, ECO:0000269|PubMed:19446523, ECO:0000269|PubMed:26084028, ECO:0000269|PubMed:27426947, ECO:0000269|PubMed:9398839, ECO:0000269|PubMed:9888391}. Note=The disease is caused by mutations affecting the gene represented in this entry. Most of the mutations alter the nucleus-cytoplasm distribution of AIRE and disturb its association with nuclear dots and cytoplasmic filaments. Most of the mutations also decrease transactivation of the protein. The HSR domain is responsible for the homomultimerization activity of AIRE. All the missense mutations of the HSR and the SAND domains decrease this activity, but those in other domains do not. The AIRE protein is present in soluble high-molecular-weight complexes. Mutations in the HSR domain and deletion of PHD zinc fingers disturb the formation of these complexes (PubMed:14974083). Heterozygous mutations within the PHD1 domain have dominant-negatif effects and cause organ-specific autoimmune diseases (PubMed:26084028). Patients harbor extremely high-affinity, neutralizing autoantibodies, particularly against specific cytokines such as type I interferons which could protect them from some types of autoimmune diseases, like type I diabetes (PubMed:27426947). {ECO:0000269|PubMed:14974083, ECO:0000269|PubMed:26084028, ECO:0000269|PubMed:27426947}.;
- Pathway
- Primary immunodeficiency - Homo sapiens (human);Ubiquitin mediated proteolysis - Homo sapiens (human)
(Consensus)
Recessive Scores
- pRec
- 0.593
Intolerance Scores
- loftool
- 0.124
- rvis_EVS
- -0.57
- rvis_percentile_EVS
- 19.01
Haploinsufficiency Scores
- pHI
- 0.196
- hipred
- N
- hipred_score
- 0.438
- ghis
- 0.434
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.923
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Aire
- Phenotype
- vision/eye phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); digestive/alimentary phenotype; immune system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); liver/biliary system phenotype; respiratory system phenotype; neoplasm; normal phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); reproductive system phenotype; growth/size/body region phenotype; hematopoietic system phenotype; homeostasis/metabolism phenotype; endocrine/exocrine gland phenotype;
Gene ontology
- Biological process
- peripheral T cell tolerance induction;central tolerance induction to self antigen;regulation of transcription, DNA-templated;regulation of translation;immune response;humoral immune response;chemokine production;negative thymic T cell selection;positive regulation of transcription, DNA-templated;positive regulation of transcription by RNA polymerase II;thymus epithelium morphogenesis;regulation of thymocyte migration
- Cellular component
- nucleus;cytoplasm;nuclear body
- Molecular function
- RNA polymerase II regulatory region sequence-specific DNA binding;DNA-binding transcription factor activity, RNA polymerase II-specific;DNA-binding transcription activator activity, RNA polymerase II-specific;chromatin binding;protein binding;zinc ion binding;histone binding;identical protein binding;transcription regulatory region DNA binding;translation regulator activity