21-46122897-TGAAAGGAGAACCTGGGAGGAAAGGAGA-T

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3

The NM_001849.4(COL6A2):​c.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA​(p.Pro548_Glu556del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 33)

Consequence

COL6A2
NM_001849.4 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.45
Variant links:
Genes affected
COL6A2 (HGNC:2212): (collagen type VI alpha 2 chain) This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 5 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_001849.4.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
COL6A2NM_001849.4 linkuse as main transcriptc.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA p.Pro548_Glu556del disruptive_inframe_deletion 21/28 ENST00000300527.9 NP_001840.3 P12110-1A0A384MDP3
COL6A2NM_058174.3 linkuse as main transcriptc.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA p.Pro548_Glu556del disruptive_inframe_deletion 21/28 NP_478054.2 P12110-2
COL6A2NM_058175.3 linkuse as main transcriptc.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA p.Pro548_Glu556del disruptive_inframe_deletion 21/28 NP_478055.2 P12110-3

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
COL6A2ENST00000300527.9 linkuse as main transcriptc.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA p.Pro548_Glu556del disruptive_inframe_deletion 21/281 NM_001849.4 ENSP00000300527.4 P12110-1
COL6A2ENST00000397763.6 linkuse as main transcriptc.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA p.Pro548_Glu556del disruptive_inframe_deletion 21/285 ENSP00000380870.1 P12110-2
COL6A2ENST00000409416.6 linkuse as main transcriptc.1641_1667delACCTGGGAGGAAAGGAGAGAAAGGAGA p.Pro548_Glu556del disruptive_inframe_deletion 20/275 ENSP00000387115.1 P12110-3
COL6A2ENST00000413758.1 linkuse as main transcriptc.264_290delACCTGGGAGGAAAGGAGAGAAAGGAGA p.Pro89_Glu97del disruptive_inframe_deletion 6/113 ENSP00000395751.1 H7C0M5

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Bethlem myopathy 1A Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpFeb 24, 2022In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant disrupts the triple helix domain of COL6A2. Glycine residues within the Gly-Xaa-Yaa repeats of the triple helix domain are required for the structure and stability of fibrillar collagens (PMID: 7695699, 8218237, 19344236). In COL6A2, missense variants at these glycine residues are significantly enriched in individuals with autosomal dominant disease (PMID: 15689448, 24038877) compared to the general population (ExAC). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 476455). This variant has not been reported in the literature in individuals affected with COL6A2-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.1641_1667del, results in the deletion of 9 amino acid(s) of the COL6A2 protein (p.Gly549_Pro557del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555874762; hg19: chr21-47542811; API